Dataset for CDS BMF of organism Salarias fasciatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A672HG10_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Salarias fasciatus GN=BMF (length=498 residues).
atggacgatgaggaggatgatgtgtttgagccagacccacgctgctggcgcacagcattcagggagataaagtgcgaaga
ccggggcacgcagacgcctggccctgtcctggtgcccaacaacggcatgctgccctgtggagtcgcagaggaacccagac
cactcttctacggtaacgcaggttttcgattgcacttcccggcacactttgagcttgtgggggatcaccgagtgaggcgg
agagaaagcgaagagcagcagaacgggatggatcagctgccccggcagcggcctgcggcgcaaagcgtggaggcttgcat
cggacagaagctccagctcataggagaccagtttcaccgggaacacctgcaactgtatcaccgaaaccaaaggaaccagg
ggccgctgtggtggcgcctggccacaaccctcctcagccttctgtttgatcggggcgtcatcgccggaggaggaggaggc
ggtgcgggacggaggtga
© 1998-2020Legal notice