Dataset for CDS BCL2L11 of organism Pseudonaja textilis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A670Y3D3_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pseudonaja textilis GN=BCL2L11 (length=594 residues).
atggcaaaacaatcttctgatttaaattctgagtgtgagagagaaggtggacaattgcagcctgctgaaaggccagctca
gcctcatcaccttcggcctggggcccctacctccttacaaactgaatatcaaggtaatcatttgggtgaacgggacagtt
catcacccggtagccctcagggaccactggcaccaccctccagtcccagtccatttgcaaccagatccccgttgttcatg
tttgtaagaagatccccactgctgtccagatcctccagtgggtatttctcttttgacatcgacaggagtcctgcacctat
gaattgtgacaaagcaacacagactccaagtcctccgtgtcaagctatcaatcattatctaagtgcaatggcttccagat
ggcagtcacggccaatacctgaggatatgcagccagaaatatggattgcacaggaattacggcgtattggagatgaattt
aatgcttcctactgtccaagaaggggtttattggattaccagggagtaaatcaccagatcataattttgcgccttttgca
ttatatcgtccgcttcatatggagaatgcagtga
© 1998-2020Legal notice