Dataset for CDS BAD of organism Pelusios castaneus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C8R9Q6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Pelusios castaneus GN=BAD (length=564 residues).
agttcccggtcgaggtgttcccggggcaagaaaaagagtcgcctgtcccctcagagccgcggggggggggacgcgcccgg
cttcaagcagccaggcacgcccacagctggtgagaccccccccctccgattgggtggggcaggagtccagccccccccca
cacccccgagggtgggtcaatccatgatctccaaaccctccatttccttctcttcacagagctgcgaagccgaattgggt
cggaccccgcatctctggagccagaagctcaggatgagccaggtggggcattcttccggggccgctcccactcagccccc
ccccatcctatgggctgctatgcgttatgggcgggaactgcgcaggatgagtgacgagtttgacgtggctctacaggtgc
tgccacgccccaggagtgcaggcacagcatcacagctgcaccgggggagcagctggaaggagactatccaggcctggttg
gggcacaagcctgcccgtgatgtcccccgaaaagccccaagtgactgcagcccccctgcggtggagatgggaccagcccc
ttga
© 1998-2022Legal notice