Dataset for CDS BCL2L11 of organism Pavo cristatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9EIW6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Pavo cristatus GN=BCL2L11 (length=690 residues).
atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggccgggcggctgccgccgggagaggggccgggccc
ggccgtcccgctgcggcccggagcccccgccgcgctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgt
tcgccatccgctcgccgctcttcttcttcgtgcggaggtccccgctgctgccgcgctcctccagcgggtacttctccttc
gaggccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccccagcccgccgtgccaggccgtcagcca
ctacctgagcgccatggcttccaggtggcgatctcactcactcgcagaagaaatacaaccagaaatatggattgcacagg
agctgcggcgcatcggggatgaattcaatgcctcctattgtccgagaagggtaattttcttatttttactttccatttct
ttacgcacagcctctaaaagggaaaagcttaatcatatctggaaactagctctgtggcaagtgttttgctcactcaaatg
tagaaaaggatgcgcgggtggctgtcgtctgctgccgccgcgtcattcaatacactcagcatcacctttcgagttgggac
cggagattttcgggtgtcgtggcttcattcatggtactgagagccagtaa
© 1998-2022Legal notice