Dataset for CDS PMAIP1 of organism Panthera tigris altaica

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C9J1B3_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Panthera tigris altaica GN=PMAIP1 (length=156 residues).
tggtgttccttaagtattaagacagtcaaaatgagccctgggagagtcccccccgaagtggaatgtgccatgcagctccg
gagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaacctga
>gnl|bcl2dbcds|A0A8C9J1B3_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Panthera tigris altaica GN=PMAIP1 (length=165 residues).
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnagcccgaagtggaatgtgccat
gcagctccggagatttggagacaaactgaatttccgacagaagcttatgaatctgatatccaaactcttccgctcgggaa
cctga
© 1998-2022Legal notice