Dataset for CDS BCL2L11 of organism Oreochromis niloticus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A669C520_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L11 (length=693 residues).
tacttatttgaaaatgctgatatgcaggctgactgcggtctgcgcatttatttctggctgtttctctgtgacgcagctga
agtcactctggggcttcctcatgcttttcctataaggcaaacagagatgtatctaccacctgtcggtgccacaggagctc
aaacatcccgtttaaaccgcggctctaccggaggaggagaaccggattcgccttcctggtgcagaaccccgaagagcttt
gacgtttttcagagccggacgatattccgcttccctcgccgttcctccagtggatatttttcctctgactgcgactcgtt
gccgagctctccgctctccccgaagccagtgatgtctgacaaagcgatacagaccccgagccccaccggacaggtgctaa
tacacgccctgcagcgcatgggtgaggtgcgcggtgaaggaccgggcacgcaacacggtgagcacagactcttcatgtat
aacagccgcattaatgtgagtgcacgcacgtggaggagtgttactaatgatagtgaaaagatgaacaaaaacatacttag
gatgttttgctatctagtttcatacttaagatgtgtttgttttcacccctttctcactgtcgagcttagtcatgaaagag
agccgtttttccactactctgatgtgctgtgcttgctattctcacatgagtaa
© 1998-2020Legal notice