Dataset for CDS BMF of organism Oreochromis aureus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A668TQU8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Oreochromis aureus GN=BMF (length=372 residues).
atggacgatgaggaggacgatgtgtttgagccaaaagccaactgttggcgcaccacattcagggagataaagtgtgaaca
tcgaggcacacagacacccggtcctgccctggtaccaaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggtgagtgttactgcactgatctcacccctgcgaggcgacaagaaatcgcggagcagcaaaacagcatg
gagcgcctgccccggcagcaacctgcggctcgcagcgtggaggcctgcatcggacagaaactccagctcataggagacca
gtttcactgggaacgcctgcaactggtgaggaggatggatgcgttcggctga
© 1998-2020Legal notice