Dataset for CDS BAD of organism Oncorhynchus kisutch

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C7DT45_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=453 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtc
tgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccggggtcgctcccagtcggccccccctgccctctgggcggccaagagatacgggcggcagctccgacgcatgag
tgacgagttcgatacgtggctggataaagggaggtgctactgcaaggtcttccgttgcagcccaaatcaaccccctacac
ttccaggcggtcccaattcattccctatcccctcgatgttaggggctggatag
>gnl|bcl2dbcds|A0A8C7DT45_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=594 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaatcgtc
tgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccggggtcgctcccagtcggccccccctgccctctgggcggccaagagatacgggcggcagctccgacgcatgag
tgacgagttcgatacgtggctggataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagt
cccccagctggtgggcctacctgttcagtcataaggagacagagagatggagaagggagaggattggaaggcggggggga
tgggcctacctgttctctcaccaagagacaacccaccgtaatcgtaccactattgaaccacggtcatcagagtacagaga
aggggatgtttcccatgccaataaagccccttga
>gnl|bcl2dbcds|A0A8C7DT45_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=1074 residues).
atgccaagactgagttggcctcctgagctaaagcttggtacaaagattcagggtctattcagggtcaagcacatgtgtaa
taatgttgtcttcctctcctctctgcctcttttctctttctcccccctttctgccctctctccatccctcttcctctctc
tctgccctctctcgctcccctctctctctgccctctctcgctcccctctctctctctccatccctcttcctctctctctg
ccctctctctctccatccctcttcctctctctctgccctctctctctctctccatccctcttcctctctctctgccctct
ctctctctctccatccctcttcctctctctctgccctctctctctctctccatccctcttcccctctctctctgccctct
ctctctctctccatccctcttcccctctctctctccatccctcttcccctctctctctgccctctctcctctctctctgc
cctctctcctctctctctgccctctctccatctctctccatccctcttcccctctctctctccatccctcttcccctcct
cactcactcttcctccatagatgtcagcatggctcagatgtttactatatcagacagcgagtcagagccctcagaggagg
taggagaaaccgaaaaggaccaatcgtctgccggaaaggggatgactggcggtccaataggccacgccctcactgtgcct
gagatgagactggcaggagagggtcggttgaggatgaactcagagtcccaggcccaggagctccagggtagggggccagg
ggtggaaggcatgcccacagacggagcatctttccggggtcgctcccagtcggccccccctgccctctgggcggccaaga
gatacgggcggcagctccgacgcatgagtgacgagttcgatacgtggctggataaaggggagatgaggcgggtgaagagt
gcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctgttcagtcataaggagacagagacagaaca
tacccctatcatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A8C7KHU4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=444 residues).
atggaccacatacatgattgtgtggatgaatgtgagtctgaccactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaacagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggaaaaagggaagacacagagtttctggatgtgatgactcctactgaggatggcgggggtgacggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggctcgacaaaggggagcccaagagagggattagcccaggaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A8C7KKS5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Oncorhynchus kisutch GN=BAD (length=429 residues).
atgaatgaacaagacgagtctgaccactcaggaaccacacactacccagaatttcagctccataatgtctccgctacgac
gagcatcagaccacgaccaggtgggcgagctcggctctactccgagtcccaggtgtgctcccaggttggcagaagggatg
acacagagtttcaggatgcaataactcctactgaggagggcgggggcgatggggctcctttccgaagccgatcacagtct
gctcctcctacactgtgggctgcaaagaaatatggccgccagctgaggaggatgagtgatgaatttgacacctggctcga
caaaggggagcccaagagagggattagcccaggaggggtcaagcaggaggtctcccggggatggttctctttcctctgga
gtccaaacgaggccgaaggcagggagtga
© 1998-2022Legal notice