Dataset for CDS Unclassified of organism Nothoprocta perdicaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C6Z5C2_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Nothoprocta perdicaria (length=267 residues).
ttggggcaggctcgacctccagaaatctggattgcacaggagctgcggcgcatcggtgatgagttcaatgcctcctattg
tccgagaagggtaacttgcaggtttttcttttccgtttcctgcttggagagggcaatgcttcgtttgcctgtgcctctga
cgcaagagaaagcctttcctcagctcttagttcggattgtctttaggagcaacctgagctgttctcctctctccagggct
ttcttcccgtgtgtgtgctggccttga
© 1998-2022Legal notice