Dataset for CDS BMF of organism Nannospalax galili

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C6R2L6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Nannospalax galili GN=BMF (length=765 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcgctgagccgtggcctcctcccgcgccagctcgtgccggcagc
cgccgctgccgcaccctgcgccacccgcctcccgccgcacccccgattgctcgtcacgctggaccctggtgcagagccct
ggcatcacgactcggaagctgagactcactcctggagtcacccaggagaaatggagccacctcagtgtgtggaggagctg
gaagatgatgtgtttcagccagaagatggggagccagggacacagtctgggagtttgctctctgctgacctgtttgccca
gagccagctggattgccccctcagccggcttcagctcttccctcttacccactgctgtggccctgggctccggcccatta
gccaggaagacaaggccactcagaccctcagtccagcctccccaagccagggtgtcatgctgccttgtggggtgacagag
gaaccccaacgactcttttacggcaatgctggctaccgacttcctctccctaccagtttccctgcaggcttgccccttgg
ggagcaggctcctgaagggcagtggcaacatcgagccgaggtacagatcgccagaaagcttcagtgcattgcagaccagt
tccaccggctccatatgcagcaataccagcagaaccgagaccgagcatggtggcaggtcttcctattcctgcacaacctg
gccttgaacagagaaggaaacagggatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C6R2L6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Nannospalax galili GN=BMF (length=570 residues).
attttcccaggagaaatggagccacctcagtgtgtggaggagctggaagatgatgtgtttcagccagaagatggggagcc
agggacacagtctgggagtttgctctctgctgacctgtttgcccagagccagctggattgccccctcagccggcttcagc
tcttccctcttacccactgctgtggccctgggctccggcccattagccaggaagacaaggccactcagaccctcagtcca
gcctccccaagccagggtgtcatgctgccttgtggggtgacagaggaaccccaacgactcttttacggcaatgctggcta
ccgacttcctctccctaccagtttccctgcaggcttgccccttggggagcaggctcctgaagggcagtggcaacatcgag
ccgaggtacagatcgccagaaagcttcagtgcattgcagaccagttccaccggctccatatgcagcaataccagcagaac
cgagaccgagcatggtggcaggtcttcctattcctgcacaacctggccttgaacagagaaggaaacagggatggggcagg
tcccaggtga
© 1998-2022Legal notice