Dataset for CDS BIK of organism Nannospalax galili

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C6Q939_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Nannospalax galili GN=BIK (length=453 residues).
atgtcagagacaagacccatggccaggggcctcttcatcgagacactgctgcaggagcagctccttctgcctccagtggc
ccctggggctccaggaatgacagagcctgtgggagaagtggacctcatggagtgcctggagggcagtaaccaggtggccc
tgcggctggcctgcattggagatgagatggatctgcaccttcggagcccccatctgacccagctgcccgggattgccatg
cacagcctggctgtcacctacagacaaacaggcattaggggtgtcctcagaagcttgacccacagcctctgcagccttgg
agagagcatatggtcctggagattcctgactcctgtcatctgggtgtcacctgaccaggcctgcaggcagctgctgccct
tggtcttgctggtcctgctgctgggcggggccctgcacctgctgcctcagtga
© 1998-2022Legal notice