Dataset for CDS BMF of organism Macaca fascicularis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2K5VLA3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5VLA3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=546 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaaaaccgaaatcgcgtgtggtggcagatc
ctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggtga
>gnl|bcl2dbcds|A0A2K5VLA3_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Macaca fascicularis GN=BMF (length=591 residues).
atggagccatctcggtgtgtggaggagctggaggatgatgtgttccagccggaggacggggagccggggtcccaacccgg
gagctctctctctgccgatctgtttgcccagagcctacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccctgtggggtaactgaggaaccccagcgactcttttacggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggctccatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccctaggcccctgac
ctggaatggggctgttgtcaaaccctgttga
© 1998-2022Legal notice