Dataset for CDS BAD of organism Lynx canadensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A667H8Z9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lynx canadensis GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcccagcgagcaggaagactcgagccctacggataggggcctgggccccagccccac
aggggaccggccccgcggccctggcaagcaccagcggacggccccaggcctcctcggggaagctggtcaccagcaggggc
agcccgccagcagcaaccaccatggaggcgctggggctgtggagacccggagtcgccacagctcgtaccccgccgggacc
gaggaggatgaagggacggaggaggaagagcctagccctttccggggtcgctcgcgctcagcgccccccaacctctgggc
tgccctgcgctacggccgcgagctccggaggatgagcgacgagttccagggctccttcaagggacttccacgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcttcatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2020Legal notice