Dataset for CDS BMF of organism Junco hyemalis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C5IIR3_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Junco hyemalis GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcagctccaggaggaccctcaggaaggtcagc
gggaagcacgtgctgaggtgcagatcgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A8C5IIR3_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Junco hyemalis GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggctttttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactattccccctcacacactgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccatcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccacggagactcttctatgggag
tgctggttaccgtttacatgtccctccagctggctttgtgttggatccgcagctccaggaggaccctcaggaaggtcagc
gggaagcacgtgctgaggtgcagatcgcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagagg
catcagcagaacagaaatcaagtgtggtggcagctttttctcttcctacacaacttggccttaaacacggaggtgaacag
gaaccacactgggcagaggtga
© 1998-2022Legal notice