Dataset for CDS BAD of organism Hucho hucho

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A4W5JLL9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=486 residues).
atggctcagatgtttactatatcagacagcgagtcagagccctcagaggaggtaggagaaaccgaaaaggaccaattggc
tgccggaaaggggatgactggcggcccaataggccacgccctcactgtgcctgagatgagactggcaggagagggtcggt
tgaggatgaactcagagtcccaggcccaggagctccagggtagggggccaggggtggaaggcatgcccacagacggagca
tctttccgggttcgctcccagtcggccccccctgccctctgggcggccaagaaatacgggcggcagctccgacgcatgag
tgacgagtttgatacgtggctggataaaggggagatgaggcgggtgaagagtgcgggagcagccaaacagatgaccaagt
cccccagctggtgggcctacctgttcagtcataaggagacagagacagaacatacccctaccatcccaccacgatcatct
gagtag
>gnl|bcl2dbcds|A0A4W5JLL9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=759 residues).
atgttgtctccctctcctcctctccctttccctacctatccactctctctctctgcctctcctcctgtctctttccctct
ctccacctctctctttccctccctctctacctctccactctctctctgccctctctccttcatctctctctaccctctct
ctccacacctcttccccctctcactccacccctcttcacctccatctcactcctttcttgtttcccctctctcactcact
cccctgcctccctcttcctccgtagatgtcagcatggctcagatgtttactatatcagacagcgagtcagagccctcaga
ggaggtaggagaaaccgaaaaggaccaattggctgccggaaaggggatgactggcggcccaataggccacgccctcactg
tgcctgagatgagactggcaggagagggtcggttgaggatgaactcagagtcccaggcccaggagctccagggtaggggg
ccaggggtggaaggcatgcccacagacggagcatctttccgggttcgctcccagtcggccccccctgccctctgggcggc
caagaaatacgggcggcagctccgacgcatgagtgacgagtttgatacgtggctggataaaggggagatgaggcgggtga
agagtgcgggagcagccaaacagatgaccaagtcccccagctggtgggcctacctgttcagtcataaggagacagagaca
gaacatacccctaccatcccaccacgatcatctgagtag
>gnl|bcl2dbcds|A0A4W5MZR2_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=444 residues).
atggaccacacacatgattgtgtggatgaatgtgagtctgatcactcaggaaccacacacaactcagaatttcagctcca
tgtctcaactacaatgagcaccagaccaagaccaggtgagcgagtccggctctactcagagtcccaggtgtgctcccagg
ttggcaaaagggaaaacacagagtttcaggatgtgatgactcctactgaggagggcggaggtgatggggcttcattccga
ggccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggctgccagctgaggaggatgagtgatgaatt
tgacacctggcttgacaaaggggagcctaagagagggattagcccaggaggaggcaagcagaaagtctcccgaggatggt
tctctttcctctggagtccaaaggaggcggaaggcagggagtga
>gnl|bcl2dbcds|A0A4W5R1T6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hucho hucho GN=BAD (length=531 residues).
atggctataatcaacactatcattcactgtggatgtcctttttctcttcagatatttacaatgaaccacacacatgattg
tgtggatgacaacccagaaaccatgaatgaaaaagatgagtctgaccactcaggaaccacacactacccagaatttcagc
tccatactgtctccactacgacgagcaccagaccacgaccaggtgggcgagtccggctctactccgagtcccaggtgttc
tcccacgttggcagaagggacgacacagagtttcaggatgcaatgactcctactgaggagggcgggggcgatggggctcc
tttccgaagccgatcacagtctgctcctcctgcactgtgggctgcaaagaaatatggccgccagctgaggaggatgagtg
atgaatttgacacctggctcgacaaaggggagcccaagagagggattagcccaggagggatcaagcaggaggtctcccga
ggatggttctctttcctctggagtccaaaggagtcggaaggcagggagtga
© 1998-2020Legal notice