Dataset for CDS BIK of organism Felis catus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A5F5XUY6_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Felis catus GN=BIK (length=738 residues).
atgaacttgggagtggacacaaacacccagagcacagcaaactggggtaaagccaattgcaaaatcagtcgccaagagaa
ttcttgtgttgtgcttcctctaggttggagtgtcttgagcaggaaaggacataaaagaaaatctccccacggcctgtttt
ccaaacgcggaattaggggtccagaggggctaaggaacttgtccggagccaaacggccaagctggactaggacccaggtg
gcccagcagccgagtgccccgtggcacagtgtccctgtgcatagagaagaaatgtctcacgcaggacccctctccaggaa
cgtctttttgagcaccttcctgcaggagcatggcccggaagttctggacgttcctggcatgaccgatctcgtggagtact
atgatcccgggccctcccctaacagcaacagccccgacgatgtggccatgcggctggccttcatcggggacgagatggag
gtgaggtggatgatgccccgcgttggcgagctgcccgggatggccgtgtacagcttggccttcacctacaaccagacggg
cctgagaggtgttctcagaagtctcatggatggtctggccaacctcagggagaacatatggatctggggcttcctgaccc
tcaggaacagggtgtcccccaactcggggcgcgggctggcgctgtccctgctgctgctggtgttgctgctgggctggggg
ctccacctcctccagtga
© 1998-2020Legal notice