Dataset for CDS BMF of organism Erpetoichthys calabaricus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C4SHZ6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BMF (length=615 residues).
atggtagctgaagtcgaagtgactctgaatatcgacccttttgtcttgtttgacagattaccattgagatcacgtatacg
tatggatccagaggaggacattgaggatgatgtgtttcatccgccagaactggacaggtacccacacacaataagtggga
cgttccgacactgcagcacttccccacgggcaaaccctttttttatttgccagcgctttcgagaagtgaaatacgtggac
cagagcacacagacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggggttcaagaggagccttcata
tctcttttacggtacagcagcccatcgcttgcacttcccagcacattttgaggtggatcgagatggggacacggaagaag
gaatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatcggccaaaagcttcaaagaattggagatcag
ttccacagagattacacacaaatgctacagcagaaccaaaggaacccccagccattgtggtggaggatggccgtcacctt
gttggcctttcttttcgatcgagatgcaggtccgaatcgaatggacgcaagatga
>gnl|bcl2dbcds|A0A8C4SHZ6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BMF (length=534 residues).
atggatccagaggaggacattgaggatgatgtgtttcatccgccagaactggacaggtacccacacacaataagtgggac
gttccgacactgcagcacttccccacgggcaaaccctttttttatttgccagcgctttcgagaagtgaaatacgtggacc
agagcacacagacgacgagtaatcacgtgccgagctacagcagcatgctgccttacggggttcaagaggagccttcatat
ctcttttacggtacagcagcccatcgcttgcacttcccagcacattttgaggtggatcgagatggggacacggaagaagg
aatggcagaagaagaacaggagcctggtctgagcgcagaagcacagatcggccaaaagcttcaaagaattggagatcagt
tccacagagattacacacaaatgctacagcagaaccaaaggaacccccagccattgtggtggaggatggccgtcaccttg
ttggcctttcttttcgatcgagatgcaggtccgaatcgaatggacgcaagatga
© 1998-2022Legal notice