Dataset for CDS classical BH3-containing proteins of organism Equus asinus asinus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C4KX59_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus asinus asinus GN=BIK (length=546 residues).
atgtctcaagtaggacccgtctccagggacctctttctggatgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcg
gggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacc
tacaaccagacaggcctgaggggtgtttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctg
gagcttcctgacccacagggacagggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctgg
agccgtggagcagctgccccgtagggcacagcctcgctggttgctgcagtccccaccaatccctattgtcttcttttgcc
tgcttcacccattcctcctcctgcctgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|A0A8C4L4F7_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Equus asinus asinus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagccggtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcgcccgccgcgcccgccctgc
tgcccgctgcctacctctgcgcccccgccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggc
ccccgcagccgtccccgagccccgcgccccgacggtccacagccctcactcttgccggccgagcagcacctggagtcgcc
ggtgcccagcgccccgggggccctggagggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccctacccaggggccgagcggc
cccggagatggagcccaactag
>gnl|bcl2dbcds|A0A8C4L824_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L11 (length=618 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagaacagcaaggtaatcccggaggcgaaggggaccgctgcccccaag
gcagccctctgggcccgctggccccaccggccagccctggcccttttgctaccagatccccgtttttcatctttgtgaga
agatcttccctgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctct
tacccacggagggtaatgctcttttccttaattctttttcttcccataccctccccccaacaacatattaaaaaaaaaac
agtgactagtaataactctgtgcttatgctggaaatgagaggtgttacctgtgtgtga
>gnl|bcl2dbcds|A0A8C4L824_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L11 (length=450 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgcaggcggtc
cctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctcttacccacg
gagggtaatgctcttttccttaattctttttcttcccataccctccccccaacaacatattaaaaaaaaaacagtgacta
gtaataactctgtgcttatgctggaaatgagaggtgttacctgtgtgtga
>gnl|bcl2dbcds|A0A8C4L824_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L11 (length=450 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagaacagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgcaggcggtc
cctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctcttacccacg
gagggtaatgctcttttccttaattctttttcttcccataccctccccccaacaacatattaaaaaaaaaacagtgacta
gtaataactctgtgcttatgctggaaatgagaggtgttacctgtgtgtga
>gnl|bcl2dbcds|A0A8C4LTR5_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Equus asinus asinus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggacgcggcccccgggccgtgtgtgcgtgcagcgcgggccgcctgggtctgcgctc
gtccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggagcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcttggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A8C4MCB2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus asinus asinus GN=BMF (length=555 residues).
atggagtcgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C4MCB2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Equus asinus asinus GN=BMF (length=609 residues).
atggagtcgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaagtaggcatgggagcttgggggggtggt
gagtcttctggggatggggggccggggcctgcctcaggactccgtctgccaagcctcaaggataaggtcctggagttttg
gcctaatgctgttgtgattcccgtggactggatgggcccgactgcgtga
>gnl|bcl2dbcds|A0A8C4MYJ3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus asinus asinus GN=BAD (length=618 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaagggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
actacgctacggccgcgagctccggaggatgagcgacgagttccagggctccttccaggtgagcgccggcgcggcgcgca
cgcccggacctgttctcccaggtcacctcccactgggctgtcccatccgagtcccagtgcacgtcgggactgacgtctca
ggacccctcccctcccacgggcctgtccccaagtcccagggcatgctgggatctgtagttccaggacccctcccctccca
ccggcctgtccccgagtcccagggcatgccgggatctgtagtccagaccgctccgtag
>gnl|bcl2dbcds|A0A8C4MYJ3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus asinus asinus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaagggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
actacgctacggccgcgagctccggaggatgagcgacgagttccagggctccttccaggcacttcctcgcccgaagagcg
cgggcacggcgacgcagatgcggcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggaga
ggaggctccgccccctcccagtga
>gnl|bcl2dbcds|A0A8C4PGL2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Equus asinus asinus GN=PMAIP1 (length=165 residues).
atgcctacaaggaaggcgcgtaagtctgggcagccgagccccacgcgagccccggcagagcttgaggctgagtgtgccat
tcaaattaggagaattggagacaaactgaatttccggcagaaacttctgaatctcatagccaaactcttccgctcaggaa
cctga
© 1998-2022Legal notice