Dataset for CDS PMAIP1 of organism Crocodylus porosus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A7M4FB17_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Crocodylus porosus GN=PMAIP1 (length=168 residues).
caaagcggccgagacagcgacacgagcgccagccccgcgccagccatgctgcccgagcgggaagcagtgagagagtgcgc
cttgcagctgcgccggatcggagaccagtgccacctgcaccagaagattttgggtctcattgcaaaacttttccgccctg
gaacgtga
© 1998-2021Legal notice