Dataset for CDS BCL2L11 of organism Chinchilla lanigera

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=333 residues).
atggccaagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccacccca
gctcaggcctggggccctgacctccctacagacggagccccaagcttccatgaggcagtctcaggctgaacctccggatt
tgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaaggagggtattc
ttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtccgcctggtgtg
gaggatgcactga
>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=897 residues).
acacgcccgggtcggcggcgctcgcggcagggaacccggaggggccagccccgcctttacctgtcccagcctgcacgcgc
cggcagccctcgcggcgcgggggcgggacttgccctccctcgcgcggaggcgggacttggcgggggcggggcccgcggtg
attggacgcgggcgcggagccgccagtcggagctgggctgccgggccgcacaggtttcacttcgctccgcgcagcctctg
ggtgctgagcttgctggagcgcagcgtcccgcgccgtcaccgccgccacaccaccgccgccagcgtattcttacagttcc
cctgcgagccttgccccactgcagtcagcaccgtcttcggcagctccagttgccccgctcccgccgccaccgcctcggcg
cccttccctggccctggtacccccaatgtctgactctgattctcgaactgagaagcgcaagaaaaaaagaccaaatggcc
aagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccaccccagctcag
gcctggggccctgacctccctacagacggagccccaagacaggagcccggcacctatgagttgtgacaaatcaacacaaa
ccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgaacctccg
gatttgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaaggagggt
attcttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtccgcctgg
tgtggaggatgcactga
>gnl|bcl2dbcds|A0A8C2UYE1_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagtagtgagtgtgacacagaaggtggacaattgcagcctgctgagaggccacccca
gctcaggcctggggccctgacctccctacagacggagccccaagacaggagcccggcacctatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgaa
cctccggatttgcgcccagagatatggatcgcacaggagttgcgccgcatcggagatgagtttaatgcctcttacccaag
gagggtattcttgaatcattaccaagcagctgaagaccagccccaaatggttatcttgcgactgttacgttacattgtcc
gcctggtgtggaggatgcactga
© 1998-2022Legal notice