Dataset for CDS PMAIP1 of organism Chelydra serpentina

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3RPK7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Chelydra serpentina GN=PMAIP1 (length=177 residues).
agtgttgacaagaaagtgtatggaattcacaaagctgatgactggttttcctttgtgtttacagcacaggaagctgtgac
ccagtgctctttgcaactacgcaaaatcggagatatatgcaacctgcagcagaagattcttaatgttattacaaaactgt
tctgcccaggaacgtga
© 1998-2022Legal notice