Dataset for CDS classical BH3-containing proteins of organism Catagonus wagneri

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A8C3W860_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Catagonus wagneri GN=PMAIP1 (length=168 residues).
atgcctggaaggaggtctcgtaggaacactcagccgaatcctacgcgggtggccctcccgccagatcctgaagtcgagtg
tgtcattcagttcagaaggattggagacaaactgaatttccggcagaaacttctgaatctgatagccaaattccgcctag
aaacttga
>gnl|bcl2dbcds|A0A8C3WID6_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Catagonus wagneri GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagcccgtagagggcctagcccgcgacggcccgcgtcccttccccct
cagccgcctggtgccctctgccgtgtcctgcggcctctgcgaacccggtctgcctgccgcccccgccgcccctaccctgc
tgcccgccgcctacctctgcgcccctaccgccccacccgccgtcaccgctgccctggggggcccccgctggccagggggt
ccccgcagccggccccgaggcccgcgacccgacggtcctcagccctcactctcgcccgcggagcagcacctggaatcgcc
ggtgcccagcgctccgggggccctggcgggcggccccacccaagcggccccgggagtccggggggaggaggagcagtggg
cccgagagatcggggcccagctgcggcggatggctgacgacctcaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccttacccagggaccgtggagc
cccggagatggagcctaattag
>gnl|bcl2dbcds|A0A8C3WID6_BBC3-02 BCL2 binding component 3 gene OS=[Eukaryota] Catagonus wagneri GN=BBC3 (length=615 residues).
ggatccgaccggcggcctgagacgcggcgcaagccacatgcgagcgggcgcctggcggcggcggcggcggcggcaacaaa
atcatcggcagcggtggccaggacgcggacgcgcctgtggttcgaggagcagccgcggcaacaacagcaacagcagcagt
cactgcagttagagcagcagcagcagcagcggccgccaccgcagcagcagccgccgccgcagcgagcggcgctcagcggg
cgcgccctcctgaaggaagccgcccgccccccatcaccgtcccctccggcgtgttcatgcccccggggtcctcagccctc
actctcgcccgcggagcagcacctggaatcgccggtgcccagcgctccgggggccctggcgggcggccccacccaagcgg
ccccgggagtccggggggaggaggagcagtgggcccgagagatcggggcccagctgcggcggatggctgacgacctcaac
gcgctgtacgagcggcggagacaagaggagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcat
gggactcctgcccttacccagggaccgtggagccccggagatggagcctaattag
>gnl|bcl2dbcds|A0A8C3WX89_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Catagonus wagneri GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccacaggcttgccccttggcgaacagccccccgaggggcagtggcagcatcgagcagaagtacagatcgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccaacagaaccagaatcgcgtgtggtgg
caagtcctcctgtttctacacaacctcgccttgcatggagatgagaacaggaatggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A8C3X5Q0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgccgagaggcctcctca
gctcaggcctggggcccccacctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccgctggccccaccggccagccctggcccctttgccaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcgacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaagaagggtctttctgaataattaccaagcagccgaagcccacccgcaaatggttatcttacgactgttgcgcta
catcgtccgtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C3X5Q0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgccgagaggcctcctca
gctcaggcctggggcccccacctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccgctggccccaccggccagccctggcccctttgccaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcgacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaagaaggttagagcagtag
>gnl|bcl2dbcds|A0A8C3X5Q0_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L11 (length=543 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgccgagaggcctcctca
gctcaggcctggggcccccacctctctccagacagagcggcaaggtaatccggaaggagaaggggaccgctgcccccaag
gcagcccccagggcccgctggccccaccggccagccctggcccctttgccaccagatccccgcttttcatcttcgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcgacacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctc
aggctgaacccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatat
tacccaagaaggggttactgtgtgtgcgagaacccagcttcttgctggaccaggagagactga
>gnl|bcl2dbcds|A0A8C3X5Q0_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgccgagaggcctcctca
gctcaggcctggggcccccacctctctccagacagagcggcaagacaggagcccagcacccatgagttgtgacaaatcga
cacaaaccccaagtcctccttgccaagccttcaaccattatctcagtgcgatggcttccatgaggcagtctcaggctgaa
cccgcagatatgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaag
aagggtctttctgaataattaccaagcagccgaagcccacccgcaaatggttatcttacgactgttgcgctacatcgtcc
gtctggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A8C3X5Q0_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacagttgcagcctgccgagaggcctcctca
gctcaggcctggggcccccacctctctccagacagagcggcaagcttccatgaggcagtctcaggctgaacccgcagata
tgcgcccggagatatggattgcgcaggagttacggcgtattggagacgaatttaatgcatattacccaagaaggctggca
gaatgcctggcattctgcacctga
>gnl|bcl2dbcds|A0A8C3X9L5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Catagonus wagneri GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcagagtgagcaggaagactccagccctgcagataggggcctgggccccggccccac
aggggacaggcccccaggccccagcaagccctggagaacggccccagacctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcagagacccggagtcgccacagctcctacccagaggggacggag
gatgacgaagggaccgaggatgaggagctcagccccttccggggccgatcaagctcggcgccccccatcctctgggctgc
acagcgttacggccgcgagctccggaggatgagtgacgagttccagggttccttcaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagccccagctggaagcgcttcctccagtcctggtgggaccggaacttggggaga
ggaggctccgccccgtcccaatga
>gnl|bcl2dbcds|A0A8C3XDD1_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Catagonus wagneri GN=HRK (length=276 residues).
atgtgtccgtgccccctgcaccgtggccgcggccctccagccgtgtgcgcctgcagcgcgggccgcctgggtctgcgctc
ctccgccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggctcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2022Legal notice