Dataset for CDS BMF of organism Catagonus wagneri

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C3WX89_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Catagonus wagneri GN=BMF (length=552 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccagccagaggaaggggagccggggacccagcccag
gagggtctctgctgacccgtttgtccagagccagctggactgccccctcagccgtctgcagctcttccctctcacgcact
gctgtggccctgggcttcgacccaccagccaggaagacaaggccacccagactctcagtccagcctccccgagccagggt
gtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccctgc
cggtttccccacaggcttgccccttggcgaacagccccccgaggggcagtggcagcatcgagcagaagtacagatcgccc
gaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcagcaccaacagaaccagaatcgcgtgtggtgg
caagtcctcctgtttctacacaacctcgccttgcatggagatgagaacaggaatggggcaggtcccaggtga
© 1998-2022Legal notice