Dataset for CDS BCL2L11 of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=558 residues).
atgcccgcgcgtgtgtgtgcaccagtttcacaagctgttgacattgttactgtcttttgtttggggttacgaagtttagt
cccaccctctaccaaacaaaaattatgtctttattattttagaaaaagagaccaaatggcaaagcaaccttccgatgtaa
gttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctcc
ctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgcca
ggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatat
ggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaa
gcagctgaagaccacccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=705 residues).
atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggcggagcgcag
cggcgggctggccggaaggcgtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgtctcctgcatt
gtcttcgtggtgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtggtgccccgtcccgggccaga
acgctgcgctctgaagggaaggctcggacaaaaagagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctccctacagacagagc
cacaagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccac
tatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaaga
gttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagacc
acccacacatggttatcttacgactgttacgttacattgtccgcctggtgtggagaatgcattga
© 1998-2020Legal notice