Dataset for CDS BCL2L11 of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=750 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattccc
ggttttaccatcgaaagccagccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
cccaaagaattatttctgcgttaagcttcaggacgatgccacccttgatgcccacttcacgatggcctgtacatctgacc
gtgtgtgggagcctgcagcacaggatttag
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=684 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattccc
ggttttaccatcgaaagccagccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaag
cccaaagaattatttctgaaatagaaaatgtccaagatatctaa
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=504 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaa
cctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaag
gagggtaaactggatactgcccttttgccatcggaaggaagtgtgtcttgaagcattcccggttttaccatcgaaagcca
gccagagtgcttactggaccacaatcagagatcgttcaatcaatacttgctgtgccaaagcccaaagaattatttctgaa
atagaaaatgtccaagatatctaa
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggagggtatttttgaataattaccaagcagctgaagaccacccacacatggttatcttacg
actgttacgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=525 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggatatctcttctacctgattga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=516 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcctccacggcagccctcagggcccgctggccccaccggccagccccggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcctccgtgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaatctcaggctgaacctgcaggtatgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgag
tttaacgcttattatccaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=264 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagagacctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaatctcaggctgaacctgcaggta
tgcgcccggagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggaggctggca
aaactcttggcatcctccacgtga
>gnl|bcl2dbcds|A0A2R8M6L7_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L11 (length=876 residues).
atgttcccggcggctgcgacccgggccgcgagggccagaggggcagcgcgcggagccgtcggctgcccggcggagcgcag
cggcgggctggccggaaggcgtgggctctgtgctgcgccggggactctgaacccgagtcccgggctttgtctcctgcatt
gtcttcgtggtgacggtcaggggccgccgggtcggcgaaaggcgcgggtcggacgccgtggtgccccgtcccgggccaga
acgctgcgctctgaagggaaggctcggacaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtga
ccgagaaggtagacaattgcagcctgcggagagacctccccagctcagacctggggcccctacctccctacagacagagc
cacaaggtaatcctgaaggcaatcacggaggtgaaggggacagctgcctccacggcagccctcagggcccgctggcccca
ccggccagccccggcccttttgctaccagatccccgcttttcatctttgtgagaagatcctccgtgctgtctcgatcctc
cagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtgacaaatcaacacaaaccccaagtcctc
cttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaatctcaggctgaacctgcaggtatgcgcccg
gagatatggatcgcccaagagttgcggcgtatcggagacgagtttaacgcttattatccaaggagggtaatgatactttc
tttacccccttttctgcttacccctccccctccacactgtattttttttaaaaaaagacaaagtggcttgtcataa
© 1998-2022Legal notice