Dataset for CDS Unclassified of organism Caenorhabditis japonica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2H2JHB0_uncEGL1-01 Putative Egg-laying defective 1 gene OS=[Eukaryota] Caenorhabditis japonica (length=154 residues).
agacgactccgacgccgtccaaactggccgtgaaattggcgcacgcatcgccaccatgtgcgacgagtttgacgccgagc
tgatgtcattcgccaactaccccgccaaggacagaggtcttcttgcacgtgtcctcgactttttcgccttctga
© 1998-2022Legal notice