Dataset for CDS HRK of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A4W2CRW4_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos indicus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgtccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A4W2GVZ3_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Bos indicus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgccggccgcctgggtctgcgctc
gtccgccgcgcagctcacggcagcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccctacctactggccctggctgtgcgcggccgcgcaggtggcagcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2020Legal notice