Dataset for CDS BCL2L11 of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgccgagaggcctcctca
gctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatgagttgtgacaaatcca
cacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgta
cctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagtttaatgcatattacccaag
aagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttgcgctacatcgtgcgtc
tggtgtggaggatgcagtga
>gnl|bcl2dbcds|A0A3Q1MV27_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Bos taurus GN=BCL2L11 (length=516 residues).
atgccgctcagcgtgcggagttacttgtggatttggctggggtcgccaggagccggcttgggggaccttgctcccattcg
gagaaaaaaagaccaaatggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctg
ccgagaggcctcctcagctcagacctggggcccccacctctttacagacagagcggcaagacaggagcccggcacccatg
agttgtgacaaatccacacagaccccaagccctccttgccaggccttcaaccattatctcagtgcaatggcttccatgag
gcagtctcaggctgtacctgcagatacacgcccagagatatggattgcccaagagctacggcgtatcggagacgagttta
atgcatattacccaagaagggtcttcgtgcgtcaccaggcagttgagggccacccgcaaatggtcctcttgcgcgtcttg
cgctacatcgtgcgtctggtgtggaggatgcagtga
© 1998-2020Legal notice