Dataset for CDS classical BH3-containing proteins of organism Athene cunicularia

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A663MLZ1_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Athene cunicularia GN=BCL2L11 (length=201 residues).
gggtcacaggctgctcctttctcctctaaagacgtacagcccgaaatctggattgcacaggagctgcggcgcatcggaga
cgagttcaatgcctcctattgtccaagaagggtaactttcatctttttactttccatttctttacatatggcttctaaaa
gggaaaagcttaatcatctctggaaactagttctgcggtga
>gnl|bcl2dbcds|A0A663MPI8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Athene cunicularia GN=BMF (length=636 residues).
atgttattgtcgtgtcttagctgtttcctcaaatgtccctttattgcaggagcaatggatcgccccagctacctggaaga
ggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctggtgaaa
tgactgcaactggcattttcacacagaaccagtcctacagctgccttctggggaggtttcaactattccccctcacacac
tgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgtcctcttccagtcagga
tgttatgttgccttgtggagtcactgaagagccccggagactcttctatggcaatgctggttaccgtttacacgtccctc
cagttggctttgcgttggatccgcacctccaagaggagcctcgagaaggtcagcgggaagcacgtgccgaggtgcagatt
gcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagaggcatcagcagaacagaaatcaagtgtg
gtggcagctttttctcttcctacacaacttggccttaaatgcggaggcgaacaggaaccacactgggcagaggtga
>gnl|bcl2dbcds|A0A663N909_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Athene cunicularia GN=PMAIP1 (length=177 residues).
ctgccgggccaccaccacaagcggcggtgcgggtggctgacggccgtgcttgtgccctctgcagagcgggaggcggtggc
ggagtgcgccctgcagctgcgcaggataggcgacaagtgggacctgcggcagaagatcctgaacctcctcacaaagctgt
tctgcccggaaacgtga
© 1998-2020Legal notice