Dataset for CDS BMF of organism Athene cunicularia

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A663MPI8_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Athene cunicularia GN=BMF (length=636 residues).
atgttattgtcgtgtcttagctgtttcctcaaatgtccctttattgcaggagcaatggatcgccccagctacctggaaga
ggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactttggacttgcaggtcagcctggtgaaa
tgactgcaactggcattttcacacagaaccagtcctacagctgccttctggggaggtttcaactattccccctcacacac
tgctgtggtcccggtatcaggcatcctgagcagcaggacaaggcaactcaaacactcagcccgtcctcttccagtcagga
tgttatgttgccttgtggagtcactgaagagccccggagactcttctatggcaatgctggttaccgtttacacgtccctc
cagttggctttgcgttggatccgcacctccaagaggagcctcgagaaggtcagcgggaagcacgtgccgaggtgcagatt
gcacggaagttgcagtgcattgccgaccagttccaccggctccacatacagaggcatcagcagaacagaaatcaagtgtg
gtggcagctttttctcttcctacacaacttggccttaaatgcggaggcgaacaggaaccacactgggcagaggtga
© 1998-2020Legal notice