Dataset for CDS PMAIP1 of organism Ailuropoda melanoleuca

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G1LIZ7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=PMAIP1 (length=162 residues).
atcggctccctgctcagtggggagcctgcttctccctctccctctgccgcaccccctcccgaagtggagtgcgccattca
actcaggagatttggagacaaactgaatttccggcagaaacttctgaatctgatatccaaactcttccgctcaggaacct
ga
© 1998-2022Legal notice