Dataset for CDS ORFV125 of organism Pseudocowpox virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

D3IZD7_ORFV125-01      atggcaaacagaaacgaaatcgactcctccgccgtcgtggccgcctacct
D3IZF4_ORFV125-01      atggcaaacagaaacgacatcgactcctccgccgtcgtggccgcctacct
                       ***************** ********************************

D3IZD7_ORFV125-01      cgcggggcagtacgcggccgcggtagaggagcagctgacgccgcgcgagc
D3IZF4_ORFV125-01      cgcggggcagtacgcggccgcggtcgaggagcagctgacgccgcgcgagc
                       ************************ *************************

D3IZD7_ORFV125-01      gcgaggcactcgaggcccttcgcatctccggcgacgaggtccggtccccg
D3IZF4_ORFV125-01      gcgaggcgctcgcggcccttcgcatctccggcgacgaggtccggtccccg
                       ******* **** *************************************

D3IZD7_ORFV125-01      ctgctgcaggagctctccaacgccggcgactaccgcgcgaacccggagtc
D3IZF4_ORFV125-01      ctgctgcgggagctctccaacgccggcgactaccgcgcgaaccccgagaa
                       ******* ************************************ ***  

D3IZD7_ORFV125-01      ctcacacatccccgccgccctcgtctccgcactgcttgaagcccccacct
D3IZF4_ORFV125-01      ctcgcacatccccgccgccctcgtctccgcgctgctcgaagcccccacct
                       *** ************************** ***** *************

D3IZD7_ORFV125-01      cccccggccgcatggtcaccgcggtcgagctctgcgcgcagatgggccgt
D3IZF4_ORFV125-01      cccccggccgcatggtcaccgcggtcgagctctgcgcgcagatgggccgt

D3IZD7_ORFV125-01      ctctggacgcgcggccgacggctcatcgacttcgtgcggctcgtacacgt
D3IZF4_ORFV125-01      ctctggacgcgcggccgccggctcatcgacttcatgcggctcgtgcacgt
                       ***************** *************** ********** *****

D3IZD7_ORFV125-01      gctcttcgaccgcatgccgtccacggccaacgacgacctcgccgcctggc
D3IZF4_ORFV125-01      gctcttcgaccgcatgccgtccacggccaacgacgacctcgccgcctggc

D3IZD7_ORFV125-01      tgcagaccgtcgcgcgcgtgcaccggtcgcggcgctggctgcaccgctct
D3IZF4_ORFV125-01      tgcagaccgtcgcgcgcgtgcaccggtcgcggcgctggctgcaccgctct

D3IZD7_ORFV125-01      ataggcgtcggcaccgtaatggcgggcgtgggcctgctcttccttggcgt
D3IZF4_ORFV125-01      ataggtgtcggtaccgtaatggcgggcgtgggcctgctgttcctcggcgt
                       ***** ***** ************************** ***** *****

D3IZD7_ORFV125-01      gcgcgtgctgcgtcgcacttaa
D3IZF4_ORFV125-01      gcgcgtgctgcgccgcacttaa
                       ************ *********

© 1998-2020Legal notice