Dataset for CDS iridoviridae of organism Lumpfish ranavirus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q9T2R6_097R-01      atggacgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A3Q9T8U5_097R-01      atggacgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
                        ***************************** ********************

A0A3Q9T2R6_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagtgcctgcg
A0A3Q9T8U5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
                        ****************************************** *******

A0A3Q9T2R6_097R-01      cacacctgtacaccatgcattgggaaggcgtcaacctggaggaggttcac
A0A3Q9T8U5_097R-01      cacacctgtacaccatgcagtgggaaggcgtcaacctggaggaggttcac
                        ******************* ******************************

A0A3Q9T2R6_097R-01      gcatccctcctgggagacggcgttgtaaactggggtagggtggccgtgtt
A0A3Q9T8U5_097R-01      gcatccctcctgggagacggcgttgtaaactggggtagggtggccgtgtt

A0A3Q9T2R6_097R-01      tatgcacgtctgcaggtacaccgtcaggacctttccgtctagcatggata
A0A3Q9T8U5_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccgtctagcatggata
                        ******* ******************************************

A0A3Q9T2R6_097R-01      ggacagaggttgcgctgactaaatttatacaggacccaaaaatatacaag
A0A3Q9T8U5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatatacaag
                        ************* ************************** *********

A0A3Q9T2R6_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A3Q9T8U5_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag

A0A3Q9T2R6_097R-01      atgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
A0A3Q9T8U5_097R-01      atgcttagagtggttgggagcgggagtgatcactggagtgatcactggag

A0A3Q9T2R6_097R-01      tggtcctgtctctcctgtctctcctgtctctcttgttctcttga
A0A3Q9T8U5_097R-01      tgg------------------tcctgtctctcttgttctcttga
                        ***                  ***********************

© 1998-2020Legal notice