Dataset for CDS 097R of organism Epizootic haematopoietic necrosis virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A7G9TL46_097R-01      atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
D3TTY2_097R-01          atgggcgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
                        **************************************************

A0A7G9TL46_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
D3TTY2_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
                        **************************************************

A0A7G9TL46_097R-01      cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
D3TTY2_097R-01          cccacctgtacaccatgctgtgggaaggcgtcaacctggaggaggttcac
                        **************************************************

A0A7G9TL46_097R-01      gcatccctcctgggagacggcattgtaaactggggcagggtggccgcgtt
D3TTY2_097R-01          gcatccctcctgggagacggcattgtaaactggggcagggtggccgcgtt
                        **************************************************

A0A7G9TL46_097R-01      tatgcacatctgcaggtacaccgtcaggacctttccatctagcatggata
D3TTY2_097R-01          tatgcacatctgcaggtacaccgtcaggacctttccatctagcatggata
                        **************************************************

A0A7G9TL46_097R-01      gggcagaggttgctctgactaaatttatacaggacccaaagatagacgag
D3TTY2_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacgag
                        ** ***********************************************

A0A7G9TL46_097R-01      cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
D3TTY2_097R-01          cacctcagagagtggacagataggctgggtacagtcggggtgattgggag
                        **************************************************

A0A7G9TL46_097R-01      atgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
D3TTY2_097R-01          atgcttagagtggttgggagcgggagtgatcactggagtggtcctgtctc
                        **************************************************

A0A7G9TL46_097R-01      tcttgttctcttga
D3TTY2_097R-01          tcttgttctcttga
                        **************

© 1998-2021Legal notice