Dataset for CDS iridoviridae of organism Common midwife toad virus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H6WEE3_097R-01          atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
A0A0A0VDG1_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A2D0XKG8_097R-01      atggatgtgaggcaatttctgtcagactgtgaagctcccgaggagatggt
A0A2D0XMC5_097R-01      atggatgtgaggcaatttctgtcagactgcgaagctcccgaggagatggt
                        ***************************** ********************

H6WEE3_097R-01          ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
A0A0A0VDG1_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A2D0XKG8_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcatgcg
A0A2D0XMC5_097R-01      ggccctgagggccgccgcggacgccgtgggggtagacaacagggcctgcg
                        ********************************************* ****

H6WEE3_097R-01          cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A0A0VDG1_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XKG8_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac
A0A2D0XMC5_097R-01      cccacctatacaccatgctgtgggaaggcgtcaacctggaggaggttcac

H6WEE3_097R-01          gcatccctcctgggagacggcgttgtaaactggggcaggatggccgcgtt
A0A0A0VDG1_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XKG8_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
A0A2D0XMC5_097R-01      gcatccctcctgggagacggcgttgtaaactggggcagggtggccgcgtt
                        *************************************** **********

H6WEE3_097R-01          tatgcacatctgcagatacatcgtcaggacctttccgtctagcatggata
A0A0A0VDG1_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XKG8_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
A0A2D0XMC5_097R-01      tatgcacatctgcaggtacatcgtcaggacctttccgtctagcatggata
                        *************** **********************************

H6WEE3_097R-01          ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A0A0VDG1_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XKG8_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag
A0A2D0XMC5_097R-01      ggacagaggttgctctgactaaatttatacaggacccaaagatagacaag

H6WEE3_097R-01          caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A0A0VDG1_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2D0XKG8_097R-01      caactcagagagtggacagataggctgggtacagtcggggtgattgggag
A0A2D0XMC5_097R-01      caactcagagagtggacagataggctgggtacagtcagggtgattgggag
                        ************************************ *************

H6WEE3_097R-01          atgcttagagtggttgggagcg------------------------ggag
A0A0A0VDG1_097R-01      atgcttagagtggttgggagcgggagtgatcactggagtgatcactggag
A0A2D0XKG8_097R-01      atgcttagagtggttgggagcg------------ggagtgatcactggag
A0A2D0XMC5_097R-01      atgcttagagtggttgggagcg------------ggagtgatcactggag
                        **********************                        ****

H6WEE3_097R-01          tgatcactggagtggtcctgtctctcttgttctcttga
A0A0A0VDG1_097R-01      tgatcactggagtggtcctgtctctcttgttctcttga
A0A2D0XKG8_097R-01      tgatcactggagtggtcctgtctctcttgttctcttga
A0A2D0XMC5_097R-01      tgatcactggagtggtcctgtctctcttgttctcttga

© 1998-2020Legal notice