Dataset for CDS M11 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


P89884_M11-01          atgagtcataagaaaagcgggacttattgggcaaccctgattacagcctt
B1PZP0_M11-01          atgagtcataagaaaagcgggacttattgggcaaccctgattacagcctt
A0A6M4EIA3_M11-01      atgagtcataagaaaagcgggacttattgggcaaccctgattacagcctt
D0U1R1_M11-01          atgagtcataagaggactgggacttattgggcaaccataattactgcctt
                       *************  *  ****************** * ***** *****

P89884_M11-01          cttgaagactgtttctaaagtggaagaactggattgtgttgattctgctg
B1PZP0_M11-01          cttgaagactgtttctaaagtggaagaactggattgtgttgattctgctg
A0A6M4EIA3_M11-01      cttgaagactgtttctaaagtggaagaactggattgtgttgattctgctg
D0U1R1_M11-01          tttgaagtctgtttctaaggtggaagaactggattgctatgattcggatg
                        ****** ********** *****************   ****** * **

P89884_M11-01          tgttagttgatgtctctaaaataataacattgacccaggagtttagaagg
B1PZP0_M11-01          tgttagttgatgtctctaaaataataacattgacccaggagtttagaagg
A0A6M4EIA3_M11-01      tgttagttgatgtctctaaaataataacattgacccaggagtttagaagg
D0U1R1_M11-01          tgttggatgatgtctcgaaaatcataacattgactcaagagttcagaagt
                       **** * ********* ***** *********** ** ***** ***** 

P89884_M11-01          cactatgacagcgtttaccgcgcggattatggccctgccctcaagaactg
B1PZP0_M11-01          cactatgacagcgtttaccgcgcggattatggccctgccctcaagaactg
A0A6M4EIA3_M11-01      cactatgacagcgtttaccgcgcggattatggccctgccctcaagaactg
D0U1R1_M11-01          cactatgacagtgtcttccatatggattatggccctgcccttcaaaactg
                       *********** ** * **    ******************  * *****

P89884_M11-01          gaaaagagacctgtccaaacttttcacctcgttgtttgtagatgtcatca
B1PZP0_M11-01          gaaaagagacctgtccaaacttttcacctcgttgtttgtagatgtcatca
A0A6M4EIA3_M11-01      gaaaagagacctgtccaaacttttcacctcgttgtttgtagatgtcatca
D0U1R1_M11-01          gaaagggggcctggctagactttttacctcattgtttggagatgccatca
                       **** * * **** * * ****** ***** ******* ***** *****

P89884_M11-01          acagtggaagaattgttggattttttgatgttggcagatatgtgtgtgag
B1PZP0_M11-01          acagtggaagaattgttggattttttgatgttggcagatatgtgtgtgag
A0A6M4EIA3_M11-01      acagtggaagaattgttggattttttgatgttggcagatatgtgtgtgag
D0U1R1_M11-01          atagggggagaattgttggattttttgatgttggaagatatgtgtgtgaa
                       * ** ** ************************** ************** 

P89884_M11-01          gaggtactatgtcccggcagttggacggaggatcatgaattattgaacga
B1PZP0_M11-01          gaggtactatgtcccggcagttggacggaggatcatgaattattgaacga
A0A6M4EIA3_M11-01      gaggtactatgtcccggcagttggacggaggatcatgaattattgaacga
D0U1R1_M11-01          gagctactgtgtccaggcagttggacggaggaacatgatttattgaacga
                       *** **** ***** ***************** ***** ***********

P89884_M11-01          ttgcatgacacacttttttattgaaaacaatttaatgaaccattttccat
B1PZP0_M11-01          ttgcatgacacacttttttattgaaaacaatttaatgaaccattttccat
A0A6M4EIA3_M11-01      ttgcatgacacacttttttattgaaaacaatttaatgaaccattttccat
D0U1R1_M11-01          atacatgacacagttttttattgaaaacaatttaatgaactatttttccc
                        * ********* *************************** ***** *  

P89884_M11-01          tagaagacatatttttggcacagagaaaattccagaccactggctttaca
B1PZP0_M11-01          tagaagacatatttttggcacagagaaaattccagaccactggctttaca
A0A6M4EIA3_M11-01      tagaagacatatttttggcacagagaaaattccagaccactggctttaca
D0U1R1_M11-01          ttgaagacacattttgtacacagacaaaattccataacatgggatttagc
                       * ******* *****   ****** ********* * **  ** ****  

P89884_M11-01          ttcttgttgcatgccctggcgaaggtgttgcccaggatatattctgggaa
B1PZP0_M11-01          ttcttgttgcatgccctggcgaaggtgttgcccaggatatattctgggaa
A0A6M4EIA3_M11-01      ttcttgttgcatgccctggcgaaggtgttgcccaggatatattctgggaa
D0U1R1_M11-01          cttgcattgagtatcctgtgtcgggcgctgaccaggatatattctggtga
                        *    ***  *  ****     ** * ** ****************  *

P89884_M11-01          tgtgatttatgtctga
B1PZP0_M11-01          tgtgatttatgtctga
A0A6M4EIA3_M11-01      tgtgatttatgtctga
D0U1R1_M11-01          tgtgatctatgtctga
                       ****** *********

© 1998-2022Legal notice