Dataset for CDS BALF1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

56 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q99F66_BALF1-01         --------------------------------------------------
A0A4D6QN24_BALF1-0      --------------------------------------------------
A0A385JB67_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6R4T3_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1N2H2_BALF1-0      atgaaccgggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6TWI9_BALF1-0      --------------------------------------------------
A0A4D6R8R0_BALF1-0      --------------------------------------------------
A0A3R5WV36_BALF1-0      --------------------------------------------------
A0A4D6RFR1_BALF1-0      --------------------------------------------------
A0A4D6RC31_BALF1-0      --------------------------------------------------
A0A4D6RBY3_BALF1-0      --------------------------------------------------
A0A3R5WYW3_BALF1-0      --------------------------------------------------
A0A3R5WNA2_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A410I1F1_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6RE52_BALF1-0      --------------------------------------------------
A0A7G1IXW1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0A8IKW4_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6R8J3_BALF1-0      --------------------------------------------------
A0A2S1MZQ8_BALF1-0      atgaacctggccattactctggactctcctcacccaggcctcgcgtctta
A0A385JAB4_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A4D6QXN1_BALF1-0      --------------------------------------------------
A0A4D6QMD2_BALF1-0      --------------------------------------------------
A0A410J0D8_BALF1-0      --------------------------------------------------
A0A410I9N0_BALF1-0      --------------------------------------------------
A0A3R5ZJV6_BALF1-0      --------------------------------------------------
A0A3R5WKR1_BALF1-0      --------------------------------------------------
A0A0U3UKR9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MXY9_BALF1-0      atgaacctggccattgctctggactttcctcacccaggcctcgcgtctta
A0A0S2YQW9_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MV59_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MU91_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A2S1MM94_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0U3U737_BALF1-0      atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TLW1_BALF1-0      --------------------------------------------------
A0A1P7TZL6_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
P0CK59_BALF1-01         atgaacctggccattgctctggactctcctcacccaggcctcgcgtctta
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      atgaacctggccattgctctggactctcatcacccaggcctcgcgtctta
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------

Q99F66_BALF1-01         --------------------------------------------------
A0A4D6QN24_BALF1-0      --------------------------------------------------
A0A385JB67_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6R4T3_BALF1-0      --------------------------------------------------
A0A385J7X7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TV67_BALF1-0      --------------------------------------------------
A0A2S1N1Z2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1N2H2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6TWI9_BALF1-0      --------------------------------------------------
A0A4D6R8R0_BALF1-0      --------------------------------------------------
A0A3R5WV36_BALF1-0      --------------------------------------------------
A0A4D6RFR1_BALF1-0      --------------------------------------------------
A0A4D6RC31_BALF1-0      --------------------------------------------------
A0A4D6RBY3_BALF1-0      --------------------------------------------------
A0A3R5WYW3_BALF1-0      --------------------------------------------------
A0A3R5WNA2_BALF1-0      --------------------------------------------------
A0A075FFB0_BALF1-0      --------------------------------------------------
A0A075FCZ0_BALF1-0      --------------------------------------------------
A0A410I1F1_BALF1-0      --------------------------------------------------
U5YUM6_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6RE52_BALF1-0      --------------------------------------------------
A0A7G1IXW1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0A8IKW4_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6R8J3_BALF1-0      --------------------------------------------------
A0A2S1MZQ8_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A385JAB4_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A4D6QXN1_BALF1-0      --------------------------------------------------
A0A4D6QMD2_BALF1-0      --------------------------------------------------
A0A410J0D8_BALF1-0      --------------------------------------------------
A0A410I9N0_BALF1-0      --------------------------------------------------
A0A3R5ZJV6_BALF1-0      --------------------------------------------------
A0A3R5WKR1_BALF1-0      --------------------------------------------------
A0A0U3UKR9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgaact
A0A2D1LYV4_BALF1-0      --------------------------------------------------
Q91HV2_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TPI3_BALF1-0      --------------------------------------------------
A0A2S1MQV1_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7T8J1_BALF1-0      --------------------------------------------------
A0A2S1MP06_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MXY9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0S2YQW9_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TJ32_BALF1-0      --------------------------------------------------
A0A385J8K7_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MV59_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MU91_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A2S1MM94_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0U3U737_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TLW1_BALF1-0      --------------------------------------------------
A0A1P7TZL6_BALF1-0      --------------------------------------------------
K9UT94_BALF1-01         --------------------------------------------------
P0CK58_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
P0CK59_BALF1-01         tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
A0A0C7TUX3_BALF1-0      --------------------------------------------------
A0A2S1MTH2_BALF1-0      tactattctgccacgcccattttatcatataagcctgaagcccgtgagct
Q91HI3_BALF1-01         --------------------------------------------------
Q99F65_BALF1-01         --------------------------------------------------

Q99F66_BALF1-01         --------------atgaaggccgccaagtctacagattcggtgtttgtg
A0A4D6QN24_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A385JB67_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A4D6R4T3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A385J7X7_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TV67_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N1Z2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1N2H2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A4D6TWI9_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A4D6R8R0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A3R5WV36_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A4D6RFR1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A4D6RC31_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A4D6RBY3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A3R5WYW3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A3R5WNA2_BALF1-0      --------------atgaggccagccaagactacagattctgtgtttgtg
A0A075FFB0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A075FCZ0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A410I1F1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
U5YUM6_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A4D6RE52_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A7G1IXW1_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0A8IKW4_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A4D6R8J3_BALF1-0      --------------atgaagccagccaagtctacagattctgtgtttgtg
A0A2S1MZQ8_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A385JAB4_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagatgctgtgtttgtg
A0A4D6QXN1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A4D6QMD2_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A410J0D8_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A410I9N0_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A3R5ZJV6_BALF1-0      --------------atgaggccaaccaagtctacagattctgtgtttgtg
A0A3R5WKR1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A0U3UKR9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2D1LYV4_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
Q91HV2_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TPI3_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MQV1_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7T8J1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MP06_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MXY9_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0S2YQW9_BALF1-0      ggcctgacgagaccatgaggcaagccaagtctacagattctgtgtttgtg
A0A0C7TJ32_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A385J8K7_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MV59_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MU91_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A2S1MM94_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0U3U737_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TLW1_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
A0A1P7TZL6_BALF1-0      --------------atgaggccagccaagtctacagattctgtgtttgtg
K9UT94_BALF1-01         --------------atgaggccagccaagtctacagattctgtgtttgtg
P0CK58_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
P0CK59_BALF1-01         ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
A0A0C7TUX3_BALF1-0      --------------atgaggcaagccaagtctacagattctgtgtttgtg
A0A2S1MTH2_BALF1-0      ggcctgacgagaccatgaggccagccaagtctacagattctgtgtttgtg
Q91HI3_BALF1-01         --------------atgaggccggccaagtctacagattccgtgtttgtg
Q99F65_BALF1-01         --------------atgaggccagccgagtctacagattccgtgtttgtg
                                      **** *    ** ** ******** * *********

Q99F66_BALF1-01         aggaccccggtcgaggcgtgggtctcgccttccccgcccgacgacaaggt
A0A4D6QN24_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A385JB67_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6R4T3_BALF1-0      aggaccccggtcgaggcgtggatcgcgccctcgacgccagacgacaaggt
A0A385J7X7_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TV67_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1N1Z2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1N2H2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6TWI9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6R8R0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A3R5WV36_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgataaggt
A0A4D6RFR1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6RC31_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6RBY3_BALF1-0      aggaccccggtcgatgcgtgggtcgcgccctcgccgccggacgacaaggt
A0A3R5WYW3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacagggt
A0A3R5WNA2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A075FFB0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A075FCZ0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A410I1F1_BALF1-0      aagaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
U5YUM6_BALF1-01         aagaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6RE52_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgtcgccggacgacaaggt
A0A7G1IXW1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0A8IKW4_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6R8J3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MZQ8_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A385JAB4_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6QXN1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A4D6QMD2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacaacaaggt
A0A410J0D8_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A410I9N0_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A3R5ZJV6_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A3R5WKR1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0U3UKR9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2D1LYV4_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
Q91HV2_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TPI3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MQV1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7T8J1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MP06_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MXY9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0S2YQW9_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccatcgccgccggacgacaaggt
A0A0C7TJ32_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A385J8K7_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MV59_BALF1-0      aggaccccggtcgaggcgtgggtcgcgcccttgccgccggacgacaaggt
A0A2S1MU91_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MM94_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0U3U737_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TLW1_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A1P7TZL6_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
K9UT94_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK58_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
P0CK59_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A0C7TUX3_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
A0A2S1MTH2_BALF1-0      aggaccccggtcgaggcgtgggtcgcgccctcgccgccggacgacaaggt
Q91HI3_BALF1-01         aggaccccagtagaggcgtgggtcgcgccatcgcctccggacgacaaggt
Q99F65_BALF1-01         aggaccccggtcgaggcgtgggtcgcgccgtcgccgccggacgacaaggt
                        * ****** ** ** ****** ** **** *   * ** *** * * ***

Q99F66_BALF1-01         cgcggagaccagctacctcctttttagggccatgtacgcggtgttcaccc
A0A4D6QN24_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A385JB67_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6R4T3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A385J7X7_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgcca
A0A0C7TV67_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A2S1N1Z2_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A2S1N2H2_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A4D6TWI9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6R8R0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcacca
A0A3R5WV36_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6RFR1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6RC31_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6RBY3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A3R5WYW3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A3R5WNA2_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A075FFB0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A075FCZ0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A410I1F1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
U5YUM6_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6RE52_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A7G1IXW1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0A8IKW4_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6R8J3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MZQ8_BALF1-0      ggctgagtccagctacctcatgttcagagccatgtacgcggtgttcgccc
A0A385JAB4_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtatgcggtgttcaccc
A0A4D6QXN1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A4D6QMD2_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A410J0D8_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A410I9N0_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A3R5ZJV6_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A3R5WKR1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3UKR9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2D1LYV4_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
Q91HV2_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TPI3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MQV1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7T8J1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MP06_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MXY9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0S2YQW9_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TJ32_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A385J8K7_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MV59_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MU91_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MM94_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0U3U737_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TLW1_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A1P7TZL6_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
K9UT94_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK58_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
P0CK59_BALF1-01         ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A0C7TUX3_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
A0A2S1MTH2_BALF1-0      ggctgagtccagctacctcatgttcagggccatgtacgcggtgttcaccc
Q91HI3_BALF1-01         ggcggagtccagctacctcatgttcagggcaatgtacgcggtgttcaccc
Q99F65_BALF1-01         ggccgagtccagctacctcatgttcagggcaatgtacgcggtgttctccc
                         ** *** *********** * ** ** ** ***** ********* ** 

Q99F66_BALF1-01         aggacgagactgacctgcccaccccagctcaggtcctgtgccggctcatc
A0A4D6QN24_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A385JB67_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggcncanc
A0A4D6R4T3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A385J7X7_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TV67_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1N1Z2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1N2H2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6TWI9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6R8R0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A3R5WV36_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6RFR1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6RC31_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6RBY3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A3R5WYW3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A3R5WNA2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A075FFB0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A075FCZ0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A410I1F1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
U5YUM6_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6RE52_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A7G1IXW1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0A8IKW4_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6R8J3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MZQ8_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A385JAB4_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6QXN1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A4D6QMD2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A410J0D8_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A410I9N0_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A3R5ZJV6_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A3R5WKR1_BALF1-0      gggatgagacagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3UKR9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2D1LYV4_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
Q91HV2_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TPI3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MQV1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7T8J1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MP06_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MXY9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0S2YQW9_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TJ32_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A385J8K7_BALF1-0      gggatgagaaaaacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MV59_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MU91_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MM94_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0U3U737_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TLW1_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A1P7TZL6_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
K9UT94_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK58_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
P0CK59_BALF1-01         gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A0C7TUX3_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
A0A2S1MTH2_BALF1-0      gggatgagaaagacctgcctttgccagccctggtcctctgccggctcatc
Q91HI3_BALF1-01         aggatgagacgggcctgcctctgccagccatggtcctgtgccggctgatt
Q99F65_BALF1-01         gggatgagtcggacctgccgctgccggccgcggtcctgtgccggctgatc
                         *** ***     ******    ** **   ****** *******  *  

Q99F66_BALF1-01         aaggcctccctcagaaaggacaagaaactgtacgcggagctggcctgcaa
A0A4D6QN24_BALF1-0      aaggcctccctgaggaaggataggaagctatacgcagagctcgcctgcag
A0A385JB67_BALF1-0      aaggccnccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A4D6R4T3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A385J7X7_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TV67_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1N1Z2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacacggagctggcctgcag
A0A2S1N2H2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A4D6TWI9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A4D6R8R0_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A3R5WV36_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A4D6RFR1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A4D6RC31_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A4D6RBY3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A3R5WYW3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A3R5WNA2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A075FFB0_BALF1-0      aaggcctccctgaggaaggataggaggctgtacgcagagctggcctgcag
A0A075FCZ0_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A410I1F1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
U5YUM6_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A4D6RE52_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A7G1IXW1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcaaagctggcctgcag
A0A0A8IKW4_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A4D6R8J3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcagagctggcctgcag
A0A2S1MZQ8_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A385JAB4_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A4D6QXN1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A4D6QMD2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A410J0D8_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A410I9N0_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A3R5ZJV6_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A3R5WKR1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0U3UKR9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2D1LYV4_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
Q91HV2_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TPI3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MQV1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7T8J1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MP06_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MXY9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0S2YQW9_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TJ32_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A385J8K7_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MV59_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MU91_BALF1-0      aaggcctccctgaggaaggatagggagctgtacgcggagctggcctgcag
A0A2S1MM94_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0U3U737_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TLW1_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggacctggcctgcag
A0A1P7TZL6_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
K9UT94_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK58_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
P0CK59_BALF1-01         aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A0C7TUX3_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
A0A2S1MTH2_BALF1-0      aaggcctccctgaggaaggataggaagctgtacgcggagctggcctgcag
Q91HI3_BALF1-01         aaggcgtccctgaagaaggacaagaagctgtacgcggagctggcctgcaa
Q99F65_BALF1-01         aaggcctccctgaagaaggacagaaagctgtacgcggagctggcctgcaa
                        *****  **** *  ***** *     ** *** *  * ** ******* 

Q99F66_BALF1-01         gacggcggacattggaggcaagcacgcccacgtgcagctcatcatcagca
A0A4D6QN24_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A385JB67_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6R4T3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A385J7X7_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TV67_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1N1Z2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1N2H2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6TWI9_BALF1-0      gacngccgacatcgggggcaangacacgcacgtacggctcatcatcagcg
A0A4D6R8R0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A3R5WV36_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagca
A0A4D6RFR1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6RC31_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6RBY3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A3R5WYW3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A3R5WNA2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A075FFB0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A075FCZ0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A410I1F1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
U5YUM6_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6RE52_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A7G1IXW1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0A8IKW4_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6R8J3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MZQ8_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A385JAB4_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A4D6QXN1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacagctcatcatcagcg
A0A4D6QMD2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A410J0D8_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A410I9N0_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A3R5ZJV6_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A3R5WKR1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3UKR9_BALF1-0      gacagccgacatcaggggcaaagacacgcacgtacggctcatcatcagcg
A0A2D1LYV4_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
Q91HV2_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TPI3_BALF1-0      gacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MQV1_BALF1-0      gacagccgacgtcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7T8J1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
A0A2S1MP06_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggatcatcatcagcg
A0A2S1MXY9_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0S2YQW9_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TJ32_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A385J8K7_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MV59_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MU91_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MM94_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0U3U737_BALF1-0      gacagccgacatcggggacaaagacacgcacgtacggctcatcatcagcg
A0A0C7TLW1_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A1P7TZL6_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
K9UT94_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK58_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
P0CK59_BALF1-01         gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A0C7TUX3_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
A0A2S1MTH2_BALF1-0      gacagccgacatcgggggcaaagacacgcacgtacggctcatcatcagcg
Q91HI3_BALF1-01         gacggcggatatcgggggcaagcacgcgcacgtgcagctcatcatcagcg
Q99F65_BALF1-01         gacggcggacattgggggcaggcacgctcacgtccagctcatcaccagcg
                        *** ** **  *  * * **   ** * ***** * * ****** **** 

Q99F66_BALF1-01         tcctgcgcgccgtgtacgacgaccactacgactactggtcgcggctcagg
A0A4D6QN24_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A385JB67_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6R4T3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A385J7X7_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TV67_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1N1Z2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1N2H2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6TWI9_BALF1-0      tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6R8R0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A3R5WV36_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6RFR1_BALF1-0      tcctgtgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6RC31_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6RBY3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A3R5WYW3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A3R5WNA2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A075FFB0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A075FCZ0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A410I1F1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
U5YUM6_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6RE52_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A7G1IXW1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0A8IKW4_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6R8J3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MZQ8_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A385JAB4_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6QXN1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A4D6QMD2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A410J0D8_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A410I9N0_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A3R5ZJV6_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A3R5WKR1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3UKR9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2D1LYV4_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
Q91HV2_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TPI3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MQV1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7T8J1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MP06_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MXY9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0S2YQW9_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TJ32_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A385J8K7_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MV59_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MU91_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MM94_BALF1-0      tcctgcgcgcattgtacaacgaccactacgactactggtcgcggctcagg
A0A0U3U737_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TLW1_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A1P7TZL6_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
K9UT94_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK58_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
P0CK59_BALF1-01         tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A0C7TUX3_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
A0A2S1MTH2_BALF1-0      tcctgcgcgcagtgtacaacgaccactacgactactggtcgcggctcagg
Q91HI3_BALF1-01         tcctgcgcgccgtgtacgacgaccactacgactactggtcgcgtctcagg
Q99F65_BALF1-01         tcctgcgcgctgtgtacgacgaccactgcgactactggtcgcgtctcagg
                        ***** ****  ***** ********* *************** ******

Q99F66_BALF1-01         gtggtgctgtgctacgcggttgtgtttgcggtgcgaaactacctggatga
A0A4D6QN24_BALF1-0      gtggtgctgtgctacacagttgtgtttgcggtgcgaaactacctggatga
A0A385JB67_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6R4T3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A385J7X7_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TV67_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1N1Z2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1N2H2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6TWI9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6R8R0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgggtga
A0A3R5WV36_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6RFR1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6RC31_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6RBY3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A3R5WYW3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A3R5WNA2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A075FFB0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A075FCZ0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A410I1F1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
U5YUM6_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6RE52_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A7G1IXW1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0A8IKW4_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6R8J3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MZQ8_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A385JAB4_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6QXN1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A4D6QMD2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A410J0D8_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A410I9N0_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A3R5ZJV6_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A3R5WKR1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0U3UKR9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2D1LYV4_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
Q91HV2_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TPI3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MQV1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7T8J1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MP06_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MXY9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0S2YQW9_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TJ32_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctgaatga
A0A385J8K7_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MV59_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MU91_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MM94_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0U3U737_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TLW1_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A1P7TZL6_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
K9UT94_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK58_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
P0CK59_BALF1-01         gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A0C7TUX3_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
A0A2S1MTH2_BALF1-0      gtggtgctgtgctacacagtggtgtttgcggtgcgaaactacctggatga
Q91HI3_BALF1-01         gtcgtgttgtgctacacggtggtgtttgcggtgcgaaactacctggatga
Q99F65_BALF1-01         gtggtgctgtgctacacggtggtgtttgcggtgcgaaactacctggatga
                        ** *** ******** * ** ************************  ***

Q99F66_BALF1-01         ccacgagagtgccgccttcgtgctgggggccaccgcccactacctggccc
A0A4D6QN24_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A385JB67_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6R4T3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A385J7X7_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A0C7TV67_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A2S1N1Z2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A2S1N2H2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatagcccactacctggccc
A0A4D6TWI9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6R8R0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A3R5WV36_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6RFR1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6RC31_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6RBY3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A3R5WYW3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A3R5WNA2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A075FFB0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A075FCZ0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A410I1F1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
U5YUM6_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6RE52_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A7G1IXW1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0A8IKW4_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6R8J3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MZQ8_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A385JAB4_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6QXN1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A4D6QMD2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A410J0D8_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A410I9N0_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A3R5ZJV6_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A3R5WKR1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3UKR9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2D1LYV4_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
Q91HV2_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TPI3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MQV1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7T8J1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MP06_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MXY9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0S2YQW9_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TJ32_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A385J8K7_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MV59_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MU91_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MM94_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0U3U737_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TLW1_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A1P7TZL6_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
K9UT94_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK58_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
P0CK59_BALF1-01         ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A0C7TUX3_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
A0A2S1MTH2_BALF1-0      ccacaagagcgccgccttcgtgctgggggcaatcgcccactacctggccc
Q91HI3_BALF1-01         ccacgagagcgcggccttcgttctgggggccatcgcccactacctggccc
Q99F65_BALF1-01         ccacagaagtgcagccttcgttctgggggccatcgcccactacctggccc
                        ****   ** ** ******** ******** *  ****************

Q99F66_BALF1-01         tctatcgccgtgtctggtttgccaggattggcggcctgcccaggtcgctg
A0A4D6QN24_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaatatcgctg
A0A385JB67_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6R4T3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A385J7X7_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TV67_BALF1-0      tctatcgcagaatctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1N1Z2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1N2H2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6TWI9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6R8R0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A3R5WV36_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6RFR1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6RC31_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6RBY3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A3R5WYW3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A3R5WNA2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A075FFB0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A075FCZ0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A410I1F1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
U5YUM6_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6RE52_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A7G1IXW1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0A8IKW4_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6R8J3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MZQ8_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A385JAB4_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6QXN1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A4D6QMD2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A410J0D8_BALF1-0      tctatcgcagactctggtttgtgaggctgggcggcatgccaagatcgctg
A0A410I9N0_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A3R5ZJV6_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A3R5WKR1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3UKR9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2D1LYV4_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
Q91HV2_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TPI3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MQV1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7T8J1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MP06_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MXY9_BALF1-0      tctatcgcagaccctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0S2YQW9_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TJ32_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A385J8K7_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MV59_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MU91_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MM94_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0U3U737_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TLW1_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A1P7TZL6_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
K9UT94_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK58_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
P0CK59_BALF1-01         tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A0C7TUX3_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
A0A2S1MTH2_BALF1-0      tctatcgcagactctggtttgcgaggctgggcggcatgccaagatcgctg
Q91HI3_BALF1-01         tgtaccggagactctggtttgcgaggatgggcggcatgccaaggtcgctg
Q99F65_BALF1-01         tgtaccgcagactctggtttgcgaggatgggcggcatgccaagatcgctg
                        * ** **  *   ********  *** * ****** **** *  ******

Q99F66_BALF1-01         agacgccaattccctgtaacatgggctatcgccagcctgtcggacttcct
A0A4D6QN24_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A385JB67_BALF1-0      agacgtcagtttcccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6R4T3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A385J7X7_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TV67_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1N1Z2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1N2H2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6TWI9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6R8R0_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A3R5WV36_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6RFR1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6RC31_BALF1-0      agacgtcggttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6RBY3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A3R5WYW3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A3R5WNA2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A075FFB0_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A075FCZ0_BALF1-0      aaacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A410I1F1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
U5YUM6_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6RE52_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A7G1IXW1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0A8IKW4_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6R8J3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MZQ8_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A385JAB4_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6QXN1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A4D6QMD2_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A410J0D8_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A410I9N0_BALF1-0      agacgtcagttccccgtgacgtggaccctggccagcctgactgacttcct
A0A3R5ZJV6_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A3R5WKR1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3UKR9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2D1LYV4_BALF1-0      agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
Q91HV2_BALF1-01         agatgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TPI3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MQV1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7T8J1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MP06_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MXY9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0S2YQW9_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TJ32_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A385J8K7_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MV59_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MU91_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MM94_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0U3U737_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TLW1_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A1P7TZL6_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
K9UT94_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK58_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
P0CK59_BALF1-01         agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A0C7TUX3_BALF1-0      agacgtcagttccccgtgacgtgggccctggccagcctgactgacttcct
A0A2S1MTH2_BALF1-0      agacgtcagttccccgtgacgtgggccctggcaagcctgactgacttcct
Q91HI3_BALF1-01         agacgtcagttccccgtgagatgggcgctggctggcctgacttacttcct
Q99F65_BALF1-01         agacgccagttccccgtgacatgggcgatggccggcctgaccgacttcct
                        * * * *  ** ** ** *  *** *  * **  ***** *  *******

Q99F66_BALF1-01         gaaatctttgtaa
A0A4D6QN24_BALF1-0      gaaatctttgtaa
A0A385JB67_BALF1-0      gaaatctttgtaa
A0A4D6R4T3_BALF1-0      gaaatctttgtaa
A0A385J7X7_BALF1-0      gaaatctttgtaa
A0A0C7TV67_BALF1-0      gaaatctttgtaa
A0A2S1N1Z2_BALF1-0      gaaatctttgtaa
A0A2S1N2H2_BALF1-0      gaaatctttgtaa
A0A4D6TWI9_BALF1-0      gaaatctttgtaa
A0A4D6R8R0_BALF1-0      gaaatctttgtaa
A0A3R5WV36_BALF1-0      gaaatctttgtaa
A0A4D6RFR1_BALF1-0      gaaatctttgtaa
A0A4D6RC31_BALF1-0      gaaatctttgtaa
A0A4D6RBY3_BALF1-0      gaaatctttgtaa
A0A3R5WYW3_BALF1-0      gaaatctttgtaa
A0A3R5WNA2_BALF1-0      gaaatctttgtaa
A0A075FFB0_BALF1-0      gaaatctttgtaa
A0A075FCZ0_BALF1-0      gaaatctttgtaa
A0A410I1F1_BALF1-0      gaaatctttgtaa
U5YUM6_BALF1-01         gaaatctttgtaa
A0A4D6RE52_BALF1-0      gaaatctttgtaa
A0A7G1IXW1_BALF1-0      gaaatctttgtaa
A0A0A8IKW4_BALF1-0      gaaatctttgtaa
A0A4D6R8J3_BALF1-0      gaaatctttgtaa
A0A2S1MZQ8_BALF1-0      gaaatctttgtaa
A0A385JAB4_BALF1-0      gaaatctttgtaa
A0A4D6QXN1_BALF1-0      gaaatctttgtaa
A0A4D6QMD2_BALF1-0      gaaatctttgtaa
A0A410J0D8_BALF1-0      gaaatctttgtaa
A0A410I9N0_BALF1-0      gaaatctttgtaa
A0A3R5ZJV6_BALF1-0      gaaatctttgtaa
A0A3R5WKR1_BALF1-0      gaaatctttgtaa
A0A0U3UKR9_BALF1-0      gaaatctttgtaa
A0A2D1LYV4_BALF1-0      gaaatctttgtaa
Q91HV2_BALF1-01         gaaatctttgtaa
A0A0C7TPI3_BALF1-0      gaaatctttgtaa
A0A2S1MQV1_BALF1-0      gaaatctttgtaa
A0A0C7T8J1_BALF1-0      gaaatctttgtaa
A0A2S1MP06_BALF1-0      gaaatctttgtaa
A0A2S1MXY9_BALF1-0      gaaatctttgtaa
A0A0S2YQW9_BALF1-0      gaaatctttgtaa
A0A0C7TJ32_BALF1-0      gaaatctttgtaa
A0A385J8K7_BALF1-0      gaaatctttgtaa
A0A2S1MV59_BALF1-0      gaaatctttgtaa
A0A2S1MU91_BALF1-0      gaaatctttgtaa
A0A2S1MM94_BALF1-0      gaaatctttgtaa
A0A0U3U737_BALF1-0      gaaatctttgtaa
A0A0C7TLW1_BALF1-0      gaaatctttgtaa
A0A1P7TZL6_BALF1-0      gaaatctttgtaa
K9UT94_BALF1-01         gaaatctttgtaa
P0CK58_BALF1-01         gaaatctttgtaa
P0CK59_BALF1-01         gaaatctttgtaa
A0A0C7TUX3_BALF1-0      gaaatctttgtaa
A0A2S1MTH2_BALF1-0      gaaatctttgtaa
Q91HI3_BALF1-01         gaaatctttgtaa
Q99F65_BALF1-01         gaaatctttgtaa

© 1998-2022Legal notice