Dataset for CDS A9 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1L2JVL1_A9-01      atga----------------------------aaatgttgggagaacccg
O36423_A9-01          atga----------------------------aaatgttgggagaacccg
A1BM64_A9-01          atggtggaagctggcatactatcaaggaaagtaaccactgggagccactg
Q2VSG7_A9-01          atggtggaagctggcatactatcaaggaaagtaaccactgggagccactg
                      ***                             **    ******   * *

A0A1L2JVL1_A9-01      agttt-----------------------------------------aagg
O36423_A9-01          agttt-----------------------------------------aagg
A1BM64_A9-01          gactttcttcacccctcaaaccttgaagaaaggggcttgcctgtggaagg
Q2VSG7_A9-01          gactttcttcaccccccaaaccttgaagaaaggggcttgtctgtggaagg
                         **                                         ****

A0A1L2JVL1_A9-01      -------agaacat---cctctattattcattcc--------------ta
O36423_A9-01          -------agaacat---cctctattattcattcc--------------ta
A1BM64_A9-01          ctggggcagtatatttccccccagcaagcatgccccccaggaaggcattc
Q2VSG7_A9-01          ctggggcagtatatttccccccagtaagcatgccccccaggaaggcattc
                             ** * **   ** * *  *  *** **              * 

A0A1L2JVL1_A9-01      aat------gaactgtt----tttaatatta-------------------
O36423_A9-01          aat------gaactgtt----tttaatatta-------------------
A1BM64_A9-01          aatgacggggacctgctttactttaacttcactagagagatacacatgct
Q2VSG7_A9-01          aatgacggggacctgctttactttaacttcactagagagatacacatgct
                      ***      ** *** *    *****  * *                   

A0A1L2JVL1_A9-01      ----ataagaaatggattttcctgcagccacgcaaagttaatacttgatg
O36423_A9-01          ----ataagaaatggattttcctgcagccacgcaaagttaatacttgatg
A1BM64_A9-01          ccttataaagagcggcattccctgtagctatgc----taaaggcatcatg
Q2VSG7_A9-01          ccttataaagagcggcattccctgtagctatgc----taaaggcatcatg
                          ****  *  **  ** **** *** * **    * **  * * ***

A0A1L2JVL1_A9-01      aaa----cccggaagaggggcctcgagtgcagtgggcagtttgaagtcat
O36423_A9-01          aaa----cccggaagaggggcctcgagtgcagtgggcagtttgaagtcat
A1BM64_A9-01          agagctgccaggacaaaagccgtggactgcagctccaccttcgaggtgat
Q2VSG7_A9-01          agagccgccaggacaaaagccgtggactgcagctccaccttcgaggtgat
                      * *    ** ***  *  * * * ** *****       ** ** ** **

A0A1L2JVL1_A9-01      cagcaactctgtagaagcccccgagcctgagtcactggagaggattgcaa
O36423_A9-01          cagcaactctgtagaagcccccgagcctgagtcactggagaggattgcaa
A1BM64_A9-01          agtggatggggtcggacacccctctcccgagtcactggaacggatagcca
Q2VSG7_A9-01          agtggatggggtcggacacccctctcccgagtcactggaacggatagcca
                           *    ** * *  ****   ** ***********  **** ** *

A0A1L2JVL1_A9-01      aaacactcttcacaccccgtccacactgggggaggctggtggcatttcta
O36423_A9-01          aaacactcttcacaccccgtccacactgggggaggctggtggcatttcta
A1BM64_A9-01          agtcgcttttcaccccacggcccaactggggtcgggttgtgatgtttttt
Q2VSG7_A9-01          agtcgctattcaccccacggcccaactggggtcgggttgtgatgtttttt
                      *  * ** ***** ** ** **  *******  ** * ***   *** * 

A0A1L2JVL1_A9-01      gcatacttggcttatttgcagaagaattcaacagagaaactcttctggaa
O36423_A9-01          gcatacttggcttatttgcagaagaattcaacagagaaactcttctggaa
A1BM64_A9-01          gcctatttgttttacctgcaaataagctccacccagaaggttttttttcg
Q2VSG7_A9-01          gcctatttgttttacctgcaaataagctccacccagaaggttttttttcg
                      ** ** ***  ***  **** *  *  ** **  ****  * ** *    

A0A1L2JVL1_A9-01      tgaccacttgaaaaaactcaaacaaatagtcaagtgccacatcgtgccct
O36423_A9-01          tgaccacttgaaaaaactcaaacaaatagtcaagtgccacatcgtgccct
A1BM64_A9-01          ggaccattacaagaagattgaaagcatcatagaggcacatatagttccct
Q2VSG7_A9-01          ggaccattacaagaagattgaaagcatcatagaggcacatatagttccct
                       ***** *  ** **  *  **   **  *  **   ** ** ** ****

A0A1L2JVL1_A9-01      ggaccctgggaccgagagatccaaaaccgaaacagcgtccatttgataaa
O36423_A9-01          ggaccctgggaccgagagatccaaaaccgaaacagcgtccatttgataaa
A1BM64_A9-01          ggactctctcgcagcggaaactcaa---ggagccttttccact--aaaaa
Q2VSG7_A9-01          ggactctctcgcagcggaaactcaa---ggagccttttccact--aaaaa
                      **** **    * * *  * *  **   * * *    **** *  * ***

A0A1L2JVL1_A9-01      ttacctagcgccttttatttcttaaccgcagcagcttcttgtttgacgct
O36423_A9-01          ttacctagcgccttttatttcttaaccgcagcagcttcttgtttgacgct
A1BM64_A9-01          tgagggaa-gtggttatttttttcaccacagtggcgtcc--ctggtagct
Q2VSG7_A9-01          tgagggaa-gtggttatttttttcaccacagtggcgtcc--ctggtagct
                      * *   *  *   **  *** ** *** ***  ** **    * *  ***

A0A1L2JVL1_A9-01      actgcttctatacttccgaaccactcaaacgaaatga
O36423_A9-01          actgcttctatacttccgaaccactcaaacgaaatga
A1BM64_A9-01          a-tgcttctgttctgtagacgcgcgtg---gagctag
Q2VSG7_A9-01          a-tgcttctgttatgcagacgcgcgtg---gggctag
                      * ******* *  *   **  * *      *   *  

© 1998-2020Legal notice