Dataset for CDS herpesviridae of organism Panine gammaherpesvirus 1

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q99F65_BALF1-01      atgaggccagccgagtctaca---gattccgtgtttgtgaggaccccggt
Q9IHR2_BHRF1-01      atg------gcctattcaacaagggatatactgttag-------ccctgt
                     ***      *** * ** ***   ***    **** *       *** **

Q99F65_BALF1-01      cgaggcgtgggtcgcgccgtcgccgccggacgacaaggtggccgagtcca
Q9IHR2_BHRF1-01      gtatgcggga--------------------------------------ca
                       * *** *                                       **

Q99F65_BALF1-01      gctacctcatgttcagggcaa--------tgtacgcggtgtt----ctcc
Q9IHR2_BHRF1-01      gttac-----gtgcatggaaatggatctttgcatcctgtgttggagctag
                     * ***     ** ** ** **        ** *  * *****    **  

Q99F65_BALF1-01      cgggatgagtcggacctgc---cgctgccggccgcggtcctgtg--ccgg
Q9IHR2_BHRF1-01      cagcaagagaaacacctcctcgcgtttccccagaagatactgtggttttg
                     * * * ***    **** *   ** * **      * * *****     *

Q99F65_BALF1-01      ctgatcaaggcctccctgaagaaggacagaaagctgtacgcggagctggc
Q9IHR2_BHRF1-01      cggttacatttgttgcttgaggaggtaattcagcaaaatgcagaatcatt
                     * * *  *    *  **  ** ***  *   ***   * ** **      

Q99F65_BALF1-01      ctgcaagac--ggcggacattgggggcaggcac-gctcacgtccagctca
Q9IHR2_BHRF1-01      tacaaacacttgggagacatttataacaaacgctgaacacgt--------
                         ** **  **  ******     **  * * *  *****        

Q99F65_BALF1-01      tcaccagcgtcctgcgcgctgtgtacgacga------ccactgcgactac
Q9IHR2_BHRF1-01      ggacctggattttgc-cgctgtatttgaagatatatttcaccgtggagat
                       *** *  *  *** ****** *  ** **       *** * *   * 

Q99F65_BALF1-01      tggtcgcgtctcagggtggtgctgtgctacacgg--tggtgtttgcgg--
Q9IHR2_BHRF1-01      ccatc---ccttgggcgagcgttggcctggctggcctggtgtatgcatgc
                        **    **  **   * * **  **    **  ****** ***    

Q99F65_BALF1-01      -tgcgaaactacctggatgaccacagaa----------------gtgcag
Q9IHR2_BHRF1-01      ctgcaggacattgtgcaggaac-cagaacactccttactatgttgtggac
                      ***   **    ** * ** * *****                *** * 

Q99F65_BALF1-01      ccttcgttctgggggccatcgcccactacctggccctgtaccgcagactc
Q9IHR2_BHRF1-01      ctgtcagttcgtgggatgttggaagcca----gcgaaggcctggatgctt
                     *  **  *  * ***   * *    * *    **   *  * * *  ** 

Q99F65_BALF1-01      tggtttgcgaggatgggcggcatgccaagatcgctgagacgccagttccc
Q9IHR2_BHRF1-01      ggattcatcaaca-gggtggctggactggtctaattaggagcgactctct
                      * **    *  * *** ***  * *  *     * **  ** * *  * 

Q99F65_BALF1-01      cg------------tgacatgggcgatg------gccggcctgac--cga
Q9IHR2_BHRF1-01      tggctccacaaactctagatggactttgctttttgccggactgactttga
                      *              * **** *  **      ***** *****   **

Q99F65_BALF1-01      cttcctgaaatctttgtaa-------------------------------
Q9IHR2_BHRF1-01      gtctgttaattgtatgtagctatttatttatctctagaggaagacactaa
                      *   * ** * * ****                                

© 1998-2022Legal notice