Dataset for CDS asfarviridae of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0C5AZD3_LMW5HL-      atggagggagaagagctcatatatcataatatcattaatgaaatactcgt
E0WMH9_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D4I5M9_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JLP1_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
D0Q0E8_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
P42485_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
A9JKY0_LMW5HL-01        atggagggagaagagttaatatatcataatatcattaatgaaatactagt
                        *************** * ***************************** **

A0A0C5AZD3_LMW5HL-      gggatatattaaatattacatgaatgatatttcagagcatgaacttagcc
E0WMH9_LMW5HL-01        gggatatattaaatattacattaatgatatttcagagcatgagcttagcc
D4I5M9_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JLP1_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
D0Q0E8_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
P42485_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
A9JKY0_LMW5HL-01        gggttatattaaatattacattaatgatatttcagagcatgagcttagcc
                        *** ***************** ******************** *******

A0A0C5AZD3_LMW5HL-      cgtaccagcaacaaataaaaaaaattttaacctattatgatgattgtttg
E0WMH9_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D4I5M9_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JLP1_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
D0Q0E8_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
P42485_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
A9JKY0_LMW5HL-01        catatcaacaacaaataaaaaaaattttaacctattatgatgagtgtttg
                        * ** ** *********************************** ******

A0A0C5AZD3_LMW5HL-      aacaagcaggttacaattaccttttctcttacgagtgcccaagaaattaa
E0WMH9_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgttcaagaaattaa
D4I5M9_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
A9JLP1_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
D0Q0E8_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
P42485_LMW5HL-01        aacaaacaggttacaattaccttttctcttacgagtgtccaagaaattaa
A9JKY0_LMW5HL-01        aacaaacaggttataattaccttttctcttacgagtgtccaagaaattaa
                        ***** ******* ***********************  ***********

A0A0C5AZD3_LMW5HL-      aacccagtttactgaggttgtgactgagttgtttaaggatcttatcaact
E0WMH9_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D4I5M9_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JLP1_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
D0Q0E8_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
P42485_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
A9JKY0_LMW5HL-01        aacccagtttactggggttgtgactgagctgtttaaggatcttatcaact
                        ************** ************* *********************

A0A0C5AZD3_LMW5HL-      ggggtagaatttgtggatttatcgtcttttctgccaggatggcaaagtac
E0WMH9_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D4I5M9_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JLP1_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
D0Q0E8_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
P42485_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
A9JKY0_LMW5HL-01        ggggtagaatttgtggatttatcgtcttttctgccaagatggcaaagtat
                        ************************************ ************ 

A0A0C5AZD3_LMW5HL-      tgcaaagatgccaacaaccatctggagtccacggtgatcactacggcata
E0WMH9_LMW5HL-01        tgcaaagatgccaataaccatctggagtccacggtgatcactacggcata
D4I5M9_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JLP1_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
D0Q0E8_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
P42485_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
A9JKY0_LMW5HL-01        tgcaaagacgccaataaccatctggagtccacggtgatcactacggcata
                        ******** ***** ***********************************

A0A0C5AZD3_LMW5HL-      caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
E0WMH9_LMW5HL-01        caactttatgaaacacaacctactaccctggatgatttcccacggcggtc
D4I5M9_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JLP1_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
D0Q0E8_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
P42485_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
A9JKY0_LMW5HL-01        caacttcatgaaacacaacctactaccctggatgatttcccacggcggtc
                        ****** *******************************************

A0A0C5AZD3_LMW5HL-      aagaggagtttttggctttctctctacacagtgacatttattccgtgatt
E0WMH9_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattctgtgatt
D4I5M9_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JLP1_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
D0Q0E8_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
P42485_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
A9JKY0_LMW5HL-01        aagaggagtttttggctttctctctacacagtgacatgtattccgtgatt
                        ************************************* ***** ******

A0A0C5AZD3_LMW5HL-      tttaatattaaatatttcttatctaaattttgtaatcacatgtttttaag
E0WMH9_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D4I5M9_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JLP1_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
D0Q0E8_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
P42485_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
A9JKY0_LMW5HL-01        tttaatattaaatatttcttatctaaattttgtaatcacatgtttttcag
                        *********************************************** **

A0A0C5AZD3_LMW5HL-      atcctgtgtacatttattaagaaactgcaatttgatctag
E0WMH9_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D4I5M9_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JLP1_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
D0Q0E8_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
P42485_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
A9JKY0_LMW5HL-01        atcctgtgtacagttattaagaaactgcaatttgatatag
                        ************ *********************** ***

© 1998-2020Legal notice