Dataset for CDS E1B19K of organism Simian adenovirus 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q695T5_E1B19K-01      atggacttgtacgagagcctagagaatctaagttctttgcgacgtttgct
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      ggaggaggcctccgacagaacctcttacatttggaggtttctgttcggtt
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      cccctctgagtcgctttctttaccgggtgaagcgagagcacctgacggaa
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      tttgatgggcttttagagcagctgcctgggctgtttgattctttgaatct
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      cggccaccggacgctgctagaggagaggctttttccacaattggactttt
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      cctctccaggccgtctgtgttccgcgcttgcttttgctgtacatctgttg
Q695T5_E1B19K-02      --------------------------------------------------
                                                                        

Q695T5_E1B19K-01      gacagatggaacgagcagacgcagctcagcccgggttatactctggactt
Q695T5_E1B19K-02      -----atggaacgagcagacgcagctcagcccgggttatactctggactt
                           *********************************************

Q695T5_E1B19K-01      cctgacgctatgcctatggaagttcggaatcaggagggggaggaagctgt
Q695T5_E1B19K-02      cctgacgctatgcctatggaagttcggaatcaggagggggaggaagctgt
                      **************************************************

Q695T5_E1B19K-01      acgggcgcttggtggagaggcatccgtctctgcgccagcagcgtctgcaa
Q695T5_E1B19K-02      acgggcgcttggtggagaggcatccgtctctgcgccagcagcgtctgcaa
                      **************************************************

Q695T5_E1B19K-01      gctcaagtgctgctgaggcgggaggatctggaagccatttcggaggagga
Q695T5_E1B19K-02      gctcaagtgctgctgaggcgggaggatctggaagccatttcggaggagga
                      **************************************************

Q695T5_E1B19K-01      gagcggcatggaagagaagaatccgagagcggggctggaccctccggcgg
Q695T5_E1B19K-02      gagcggcatggaagagaagaatccgagagcggggctggaccctccggcgg
                      **************************************************

Q695T5_E1B19K-01      aggagtag------------------------------------------
Q695T5_E1B19K-02      aggagtaggggggataccggacccttttcctgagttggctttgggggcgg
                      ********                                          

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tggggggcgcttctgtggtacgtgaggatgaagaggggcgccaacgcggt
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      cagaagagggagcattttgagtcctcaactttcttggctgatgtaaccgt
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ggccctgatggcgaaaaacaggctggaggtggtgtggtacccggaagtat
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gggaggactttgagaagggggacttgcacctgctggaaaaatataacttt
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gagcaggtgaaaacatactggatgaacccggatgaggactgggaggtggt
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tttgaaccgatacggcaaggtagctttacgtcccgactgtcgctaccagg
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ttcgcgacaaggtggtcctgcgacgcaacgtgtacctgttgggcaacggc
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gccaccgtggagatggtggaccccagaaggggtggttttgtggccaatat
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gcaagaaatgtgccctggggtggtgggcttgtctggggtgacttttcata
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gtgtgaggtttagcggtagtaattttgggggtgtggttattaccgcgaac
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      actcctgtggtcctgcataattgctacttttttggcttcagcaacacctg
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tgtggaaatgagggtgggcggcaaagtgcgcgggtgttccttttacgctt
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gctggaagggggtggtgagccagggtaaggctaaagtgtctgttcacaag
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tgtatgttggagcgatgcaccttgggcatttccagtgagggcttcctcca
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      cgccggcgacaacgtggcttctgacaacggctgcgcctttcttatcaagg
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gaggggggcgcatttgccacaacatgatatgcggccctggggatgtgccc
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ccaaagccttaccagatggttacctgcacagatggcaaggtgcgcatgct
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      caagcctgtgcacattgtgggccaccggcgccaccgctggccagagtttg
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      aacacaatgtgatgacccgctgtagcttgtacctgggaggcaggcgagga
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gtttttatgcccagacagtgtaacctggcccactgcaacgtgatcatgga
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      acaatccgccgctacccaggtttgctttggaggaatatttgatataagca
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tggtggtgtataagatcctgcgctacgacgactgccgggctcgtactcga
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      acctgcgactgcggagcctctcacctgtgtaacctgactgtgatggggat
                                                                        

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ggtgactgaggaggtgcgactggaccactgtcagcactcttgcctgcggg
                                                                        

Q695T5_E1B19K-01      --------------------------------
Q695T5_E1B19K-02      aggagttttcttcctcagacgaggaggactag
                                                      

© 1998-2020Legal notice