Dataset for CDS adenoviridae of organism Simian adenovirus 3

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q695T5_E1B19K-01      atggacttgtacgagagcctagagaatctaagttctttgcgacgtttgct
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      ggaggaggcctccgacagaacctcttacatttggaggtttctgttcggtt
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      cccctctgagtcgctttctttaccgggtgaagcgagagcacctgacggaa
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      tttgatgggcttttagagcagctgcctgggctgtttgattctttgaatct
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      cggccaccggacgctgctagaggagaggctttttccacaattggactttt
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      cctctccaggccgtctgtgttccgcgcttgcttttgctgtacatctgttg
Q695T5_E1B19K-02      --------------------------------------------------

Q695T5_E1B19K-01      gacagatggaacgagcagacgcagctcagcccgggttatactctggactt
Q695T5_E1B19K-02      -----atggaacgagcagacgcagctcagcccgggttatactctggactt

Q695T5_E1B19K-01      cctgacgctatgcctatggaagttcggaatcaggagggggaggaagctgt
Q695T5_E1B19K-02      cctgacgctatgcctatggaagttcggaatcaggagggggaggaagctgt

Q695T5_E1B19K-01      acgggcgcttggtggagaggcatccgtctctgcgccagcagcgtctgcaa
Q695T5_E1B19K-02      acgggcgcttggtggagaggcatccgtctctgcgccagcagcgtctgcaa

Q695T5_E1B19K-01      gctcaagtgctgctgaggcgggaggatctggaagccatttcggaggagga
Q695T5_E1B19K-02      gctcaagtgctgctgaggcgggaggatctggaagccatttcggaggagga

Q695T5_E1B19K-01      gagcggcatggaagagaagaatccgagagcggggctggaccctccggcgg
Q695T5_E1B19K-02      gagcggcatggaagagaagaatccgagagcggggctggaccctccggcgg

Q695T5_E1B19K-01      aggagtag------------------------------------------
Q695T5_E1B19K-02      aggagtaggggggataccggacccttttcctgagttggctttgggggcgg

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tggggggcgcttctgtggtacgtgaggatgaagaggggcgccaacgcggt

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      cagaagagggagcattttgagtcctcaactttcttggctgatgtaaccgt

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ggccctgatggcgaaaaacaggctggaggtggtgtggtacccggaagtat

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gggaggactttgagaagggggacttgcacctgctggaaaaatataacttt

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gagcaggtgaaaacatactggatgaacccggatgaggactgggaggtggt

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tttgaaccgatacggcaaggtagctttacgtcccgactgtcgctaccagg

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ttcgcgacaaggtggtcctgcgacgcaacgtgtacctgttgggcaacggc

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gccaccgtggagatggtggaccccagaaggggtggttttgtggccaatat

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gcaagaaatgtgccctggggtggtgggcttgtctggggtgacttttcata

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gtgtgaggtttagcggtagtaattttgggggtgtggttattaccgcgaac

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      actcctgtggtcctgcataattgctacttttttggcttcagcaacacctg

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tgtggaaatgagggtgggcggcaaagtgcgcgggtgttccttttacgctt

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gctggaagggggtggtgagccagggtaaggctaaagtgtctgttcacaag

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tgtatgttggagcgatgcaccttgggcatttccagtgagggcttcctcca

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      cgccggcgacaacgtggcttctgacaacggctgcgcctttcttatcaagg

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gaggggggcgcatttgccacaacatgatatgcggccctggggatgtgccc

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ccaaagccttaccagatggttacctgcacagatggcaaggtgcgcatgct

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      caagcctgtgcacattgtgggccaccggcgccaccgctggccagagtttg

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      aacacaatgtgatgacccgctgtagcttgtacctgggaggcaggcgagga

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      gtttttatgcccagacagtgtaacctggcccactgcaacgtgatcatgga

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      acaatccgccgctacccaggtttgctttggaggaatatttgatataagca

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      tggtggtgtataagatcctgcgctacgacgactgccgggctcgtactcga

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      acctgcgactgcggagcctctcacctgtgtaacctgactgtgatggggat

Q695T5_E1B19K-01      --------------------------------------------------
Q695T5_E1B19K-02      ggtgactgaggaggtgcgactggaccactgtcagcactcttgcctgcggg

Q695T5_E1B19K-01      --------------------------------
Q695T5_E1B19K-02      aggagttttcttcctcagacgaggaggactag

© 1998-2022Legal notice