Dataset for CDS E1B19K of organism Human mastadenovirus A

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

T1UEX7_E1B19K-01      atggagctaga-----------agctgtg------------------ttg
T1UEX7_E1B19K-02      atggagcgagaggtcccacctgagctgggattacatgctggattacatgg
                      ******* ***           ***** *                  * *

T1UEX7_E1B19K-01      caaagttttc--------------------agagcgttcgt---------
T1UEX7_E1B19K-02      caatgcatttgtggagggcatggctgaagaggagggtttgcatttactcg
                      *** *  **                      *** *** *          

T1UEX7_E1B19K-01      ------cagcttct------------------------gcagtatacctc
T1UEX7_E1B19K-02      ctggcgcggcctctaaccatgccgccgttgcaggaggagcagcagaacac
                            * ** ***                        **** * * * *

T1UEX7_E1B19K-01      taa-----------aaac-----acttcaggtttttggaga---------
T1UEX7_E1B19K-02      tacgacggaggagtaaacatggaaccacaggtgcaagaaggccatgaacc
                      **            ****     **  *****    * **          

T1UEX7_E1B19K-01      ------------------tatctgtttggttct-----------------
T1UEX7_E1B19K-02      tgaccccgacgaagggcctagttgtgcagttgttaaaaagcgggaaagaa
                                        **  ***   *** *                 

T1UEX7_E1B19K-01      -----actttaagcaaggtggtac---atagggtga--------------
T1UEX7_E1B19K-02      aagaaagtttaaaggaaactgtccttaataggctgactgttaacctaatg
                           * *****   *    ** *   ***** ***              

T1UEX7_E1B19K-01      -------------------------------aggaagattacagagagga
T1UEX7_E1B19K-02      tctcgcccgcgcttggaaactgtatattggcagga--attacag-gatga
                                                     ****  ******* ** **

T1UEX7_E1B19K-01      att-----------------------------------------------
T1UEX7_E1B19K-02      atttaagcagggacacatgcatctacaatacaagtacagttttgagcagc

T1UEX7_E1B19K-01      tgaaaacatattggcc-------------------gactgtcc----agg
T1UEX7_E1B19K-02      taaaaacccactggctagaaccatgggaggatttagagtgtgctattaaa
                      * *****  * ****                    ** *** *    *  

T1UEX7_E1B19K-01      gcttt--------tagct-----------------tcattagatcttt--
T1UEX7_E1B19K-02      gcttttgctaaagtagctttacgccctgactgtacttataaaatctctaa
                      *****        *****                 * ** * **** *  

T1UEX7_E1B19K-01      --------------------------------------------------
T1UEX7_E1B19K-02      gacagtaactattacgtcatgtacgtacattataggcaatggggcagtag

T1UEX7_E1B19K-01      --------gccaccact-------ctgttttt------------caggaa
T1UEX7_E1B19K-02      ttgaggtggacactagtgatagagttgcttttaggtgtcgtatgcagggc
                              * *** * *        ** ****            ****  

T1UEX7_E1B19K-01      a---------gagtggtcag---------------atctttagatttttc
T1UEX7_E1B19K-02      atgggtccgggggtggtaggtttggatggcattacatttatgaatgttag
                      *         * *****  *               ** * *  ** **  

T1UEX7_E1B19K-01      atcttctgg-----------------------------------------
T1UEX7_E1B19K-02      gtttgctggagaaaaatttaagggcattatgtttgaggctaacacaagtg
                       * * ****                                         

T1UEX7_E1B19K-01      -----------------------ccgaac---------------------
T1UEX7_E1B19K-02      ttgtattgcatggtgtgtactttcttaactttaataacacgtgtgtagag
                                             *  ***                     

T1UEX7_E1B19K-01      ------------------------ggttgc---ttctat-----------
T1UEX7_E1B19K-02      tgttggaataaggtttctgccaggggttgcactttttatgggtgttggaa
                                              ******   ** ***           

T1UEX7_E1B19K-01      -------------------------------------------tgccttt
T1UEX7_E1B19K-02      ggccttggtaggtaggcccaaaagtaaaatgtctgtaaaaaagtgcttgt
                                                                 *** * *

T1UEX7_E1B19K-01      ttggcaaccgtg------------ttggataaatgga-------------
T1UEX7_E1B19K-02      ttgagaaatgcgtgcttgctttaattgtagaaggggatgctcacattaga
                      ***  **  * *            *** * **  ***             

T1UEX7_E1B19K-01      --------------------------------------------------
T1UEX7_E1B19K-02      cataatgcagcttcagaaaatacctgttttattctactgaagggaatggc

T1UEX7_E1B19K-01      -----------------------gcgagaggtc-----------------
T1UEX7_E1B19K-02      tattttaaagcacaatatggtttgcggggtgtctgatcagacaatgcgac
                                             *** *  ***                 

T1UEX7_E1B19K-01      ------ccacctgagct----gggatta----------------------
T1UEX7_E1B19K-02      ggtttgtcacctgtgctgatggaaattgtcacactttgaaaactgttcat
                             ****** ***    *  ***                       

T1UEX7_E1B19K-01      ---------catgctgg-----------------------attacatg--
T1UEX7_E1B19K-02      attgtgagtcatgctagatattgttggcctgtgtgtgaccataacatgtt
                               ****** *                       ** *****  

T1UEX7_E1B19K-01      ----------gcaatgcatttg----------------------------
T1UEX7_E1B19K-02      tatgcgctgcacaatacatttgggtctccggcggggtgtgtttagacctt
                                 **** ******                            

T1UEX7_E1B19K-01      ---------------------------------tggag-----ggcat--
T1UEX7_E1B19K-02      cccagtgtaactttagtcattcaaatgttatgttggagcccgaggcgttt
                                                       *****     *** *  

T1UEX7_E1B19K-01      ---------ggctgaagaggagggtttgcatttactcgc-----------
T1UEX7_E1B19K-02      tccagagtgagtttaaatggggtgtttg-atttatctgtggaattatgca
                                * * **  ** * ***** *****   *            

T1UEX7_E1B19K-01      ----------------tggcgcggcctctaacca-tgccgccgttgcagg
T1UEX7_E1B19K-02      agattatcaggtatgacgatgctgcccgtcatcgctgccggcagtgcgaa
                                       *  ** ***  * * *  ***** *  ***   

T1UEX7_E1B19K-01      aggagcagcag------aacactacg-------------------acgga
T1UEX7_E1B19K-02      tgtggcagtagtcatctagaacttcgccccgtcatgctgaatgtaactga
                       *  **** **      *  *** **                   ** **

T1UEX7_E1B19K-01      ggag----------------------------------------------
T1UEX7_E1B19K-02      ggagctaagaagtgaccatcttaccctgtcttgtctgcgaaccgactatg

T1UEX7_E1B19K-01      --------------------taa
T1UEX7_E1B19K-02      agtctagcgatgaagacaactaa

© 1998-2023Legal notice