Dataset for CDS E1B19K of organism Human adenovirus sp

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1Y1BYF1_E1B19K-      atgga-----------------------------tgtgtggact------
A0A513TZR1_E1B19K-      atgga-----------------------------ggcttggg--------
A0A516UYI9_E1B19K-      atgga-----------------------------ggcttggg--------
A0A516UYM9_E1B19K-      atgga-----------------------------ggcttggg--------
A0A5P8KYF0_E1B19K-      atgga-----------------------------ggtttgggct------
A0A5P8KYF0_E1B19K-      atggatccgccaaactcacttcagcaagggatacgttttggatttcatag
                        *****                                 ***         

A0A1Y1BYF1_E1B19K-      ------atccttgcagactttagcaagacacgccgg--------------
A0A513TZR1_E1B19K-      --------------agtgtttgg-aagatttttctgctgtgcgtaac---
A0A516UYI9_E1B19K-      --------------agtgtttgg-aagatttttctgctgtgcgtaac---
A0A516UYM9_E1B19K-      --------------agtgtttgg-aagatttttctgctgtgcgtaac---
A0A5P8KYF0_E1B19K-      ----------------atcttgg-aagac---------------------
A0A5P8KYF0_E1B19K-      cagcagctttgtggagaacatgg-aaggctcgcaggatgaggacaatctt
                                            * * ***                       

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      ----------------------------------------ctcagaca--
A0A5P8KYF0_E1B19K-      aaattactggccagtgcagcctctaggagtagcagggatactgagacacc
                                                                          

A0A1Y1BYF1_E1B19K-      --------------------cttgtagagga-------------------
A0A513TZR1_E1B19K-      --------------------ttgctggaaca-------------------
A0A516UYI9_E1B19K-      --------------------ttgctggaaca-------------------
A0A516UYM9_E1B19K-      --------------------ttgctggaaca-------------------
A0A5P8KYF0_E1B19K-      ----gactaggcta------ctgctagaaaa-------------------
A0A5P8KYF0_E1B19K-      caccgaccatgccagcggttctgcaggaggagcagcaggaggacaatccg
                                             *    **  *                   

A0A1Y1BYF1_E1B19K-      -----tagttcagac-----------gggtgctccgggttct--------
A0A513TZR1_E1B19K-      -----gagctctaac-----------agtacctcttggtttt--------
A0A516UYI9_E1B19K-      -----gagctctaac-----------agtacctcttggtttt--------
A0A516UYM9_E1B19K-      -----gagctctaac-----------agtacctcttggtttt--------
A0A5P8KYF0_E1B19K-      -----cgcctcggac-----------ggagtctctggccttt--------
A0A5P8KYF0_E1B19K-      agagccggcctggaccctccggtggaggagtagctgacctgtttcctgaa
                                     **            *     *     * *        

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      ctgcgacgggtgcttactaggtctacgaccagtggacagaacagaggcat
                                                                          

A0A1Y1BYF1_E1B19K-      ------ggaga---------------------------------------
A0A513TZR1_E1B19K-      ------ggagg---------------------------------------
A0A516UYI9_E1B19K-      ------ggagg---------------------------------------
A0A516UYM9_E1B19K-      ------ggagg---------------------------------------
A0A5P8KYF0_E1B19K-      ------ggaga---------------------------------------
A0A5P8KYF0_E1B19K-      taagagggagaggaatcctagtgggaataattcaagaaccgagttggctt
                              ****                                        

A0A1Y1BYF1_E1B19K-      ----------------------cactg-----gtttggaact----cctc
A0A513TZR1_E1B19K-      --------------------------------tttctgtggg----gctc
A0A516UYI9_E1B19K-      --------------------------------tttctgtggg----gctc
A0A516UYM9_E1B19K-      --------------------------------tttctgtggg----gctc
A0A5P8KYF0_E1B19K-      ----------------------ttctg-----gttcggtggt----gatc
A0A5P8KYF0_E1B19K-      taagtttaatgagccgcaggcgtcctgaaactgtttggtggcatgaggtt
                                                         **  *          * 

A0A1Y1BYF1_E1B19K-      ta--------tctcgactggtgtac---------acag-----------t
A0A513TZR1_E1B19K-      ct---cccaggcaaagttagtctgc---------agaa-----------t
A0A516UYI9_E1B19K-      ct---cccaggcaaagttagtctgc---------agaa-----------t
A0A516UYM9_E1B19K-      ct---cccaggcaaagttagtctgc---------agaa-----------t
A0A5P8KYF0_E1B19K-      ta--------gctaggctagtgttt---------agga-----------t
A0A5P8KYF0_E1B19K-      cagagcgaaggcagggatgaagtttcaatattgcaggagaaatattcact
                                   *     *    *           *              *

A0A1Y1BYF1_E1B19K-      taaga------aggattataacgaggaatttgaaaatctttttgctgat-
A0A513TZR1_E1B19K-      taagg------aggattacaagtgggaatttgaagagctttt--------
A0A516UYI9_E1B19K-      taagg------aggattacaagtgggaatttgaagagctttt--------
A0A516UYM9_E1B19K-      taagg------aggattacaagtgggaatttgaagagctttt--------
A0A5P8KYF0_E1B19K-      aaaac------aggactacagcgtagaatttgaaaagttattggacgaca
A0A5P8KYF0_E1B19K-      agaacaacttaagacctgttggttggaacctgagga-tgattgggaggtg
                          *        **   *        ***  ***  *    **        

A0A1Y1BYF1_E1B19K-      --------------tgctctggcctgctagattctc--------------
A0A513TZR1_E1B19K-      -------gaaatcctgtggtgagctgtttgattctt--------------
A0A516UYI9_E1B19K-      -------gaaatcctgtggtgagctgtttgattctt--------------
A0A516UYM9_E1B19K-      -------gaaatcctgtggtgagctgtttgattctt--------------
A0A5P8KYF0_E1B19K-      gtc--caggactt-------------tttgaagctc--------------
A0A5P8KYF0_E1B19K-      gccattaggaattatgctaagatatctctgaggcctgataaacaatatag
                                                     **  *                

A0A1Y1BYF1_E1B19K-      --------------tgaatctcggccac-cagtcc-cttttccagga---
A0A513TZR1_E1B19K-      --------------tgaatctgggtcac-caggcg-cttttccaaga---
A0A516UYI9_E1B19K-      --------------tgaatctgggtcac-caggcg-cttttccaaga---
A0A516UYM9_E1B19K-      --------------tgaatctgggtcac-caggcg-cttttccaaga---
A0A5P8KYF0_E1B19K-      --------------ttaacttgggtcat-caggct-cattttaagga---
A0A5P8KYF0_E1B19K-      aattactaagaagattaatattagaaatgcatgctacatatcagggaatg
                                      * **  *  *  *  **  *  * * *    **   

A0A1Y1BYF1_E1B19K-      ----aagggtactcc-----------------------------------
A0A513TZR1_E1B19K-      ----gaaggtcatca-----------------------------------
A0A516UYI9_E1B19K-      ----gaaggtcatca-----------------------------------
A0A516UYM9_E1B19K-      ----gaaggtcatca-----------------------------------
A0A5P8KYF0_E1B19K-      ----gaaggtt---------------------------------------
A0A5P8KYF0_E1B19K-      gggcagaggttataatagatacacaagataaagcagcttttagatgttgt
                               ***                                        

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      ----------------------------------------------ttat
A0A5P8KYF0_E1B19K-      atgatgggtatgtggccaggggttgtcggcatggaagcagtaacacttat
                                                                          

A0A1Y1BYF1_E1B19K-      acagccttgattt----------------------ttccagcccagg-gc
A0A513TZR1_E1B19K-      agactttggattt----------------------ttccacaccggg-gc
A0A516UYI9_E1B19K-      agactttggattt----------------------ttccacaccggg-gc
A0A516UYM9_E1B19K-      agactttggattt----------------------ttccacaccggg-gc
A0A5P8KYF0_E1B19K-      cagttttagattt----------------------ttctactcctgg-ta
A0A5P8KYF0_E1B19K-      gaatattaggtttagaggggatgggtataatggcattgtatttatggcta
                              * * ***                      **  *     **   

A0A1Y1BYF1_E1B19K-      gcact--acagcc--------ggggttgcttttgt---------------
A0A513TZR1_E1B19K-      gcgct--gcggct--------gctgttgctttttt---------------
A0A516UYI9_E1B19K-      gcgct--gcggct--------gctgttgctttttt---------------
A0A516UYM9_E1B19K-      gcgct--gcggct--------gctgttgctttttt---------------
A0A5P8KYF0_E1B19K-      gaact--gctgct--------gctgtagcttttct---------------
A0A5P8KYF0_E1B19K-      acactaagctgattctacatggttgtagcttttttgggtttaataatacg
                           **   * *          *  ** ****** *               

A0A1Y1BYF1_E1B19K-      --------------------------------------ggttttt-----
A0A513TZR1_E1B19K-      --------------------------------------gagtttt-----
A0A516UYI9_E1B19K-      --------------------------------------gagtttt-----
A0A516UYM9_E1B19K-      --------------------------------------gagtttt-----
A0A5P8KYF0_E1B19K-      --------------------------------------tactttt-----
A0A5P8KYF0_E1B19K-      tgtgtagaagcttgggggcaagttagtgtgaggggttgtagtttttatgc
                                                                 ****     

A0A1Y1BYF1_E1B19K-      --------------------------------------------------
A0A513TZR1_E1B19K-      --------------------------------------------------
A0A516UYI9_E1B19K-      --------------------------------------------------
A0A516UYM9_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      --------------------------------------------------
A0A5P8KYF0_E1B19K-      atgctggattgcaacatcaggtagggtcaagagtcagttgtctgtgaaga
                                                                          

A0A1Y1BYF1_E1B19K-      -----------------------------ctggttgacaaat--------
A0A513TZR1_E1B19K-      -----------------------------ataaaggataaat--------
A0A516UYI9_E1B19K-      -----------------------------ataaaggataaat--------
A0A516UYM9_E1B19K-      -----------------------------ataaaggataaat--------
A0A5P8KYF0_E1B19K-      -----------------------------atattggataaat--------
A0A5P8KYF0_E1B19K-      aatgcatgtttgagagatgtaatcttggcatactgaatgaaggtgaagca
                                                      *     *  **         

A0A1Y1BYF1_E1B19K-      -ggagc---------------cagaacac--------ccaactgagcagg
A0A513TZR1_E1B19K-      -ggagc---------------gaagaaac--------ccatctgagcggg
A0A516UYI9_E1B19K-      -ggagc---------------gaagaaac--------ccatctgagcggg
A0A516UYM9_E1B19K-      -ggagc---------------gaagaaac--------ccatctgagcggg
A0A5P8KYF0_E1B19K-      -ggatccgcc---------------aaac--------tcacttcagcaag
A0A5P8KYF0_E1B19K-      aggatccgccactgcgcagctacagaaactggctgcttcattctaataaa
                         *** *                   * **         **    *     

A0A1Y1BYF1_E1B19K-      gg---------------------ctaca--ttctggacttcgcagccatg
A0A513TZR1_E1B19K-      gg---------------------gtacc--tgctggattttctggccatg
A0A516UYI9_E1B19K-      gg---------------------gtacc--tgctggattttctggccatg
A0A516UYM9_E1B19K-      gg---------------------gtacc--tgctggattttctggccatg
A0A5P8KYF0_E1B19K-      gg---------------------atacg--ttttggat-ttcatagcagc
A0A5P8KYF0_E1B19K-      gggaaatgccagtgtgaagcataatatgatctgtggacattcggatgaga
                        **                      **       ****  *       *  

A0A1Y1BYF1_E1B19K-      cacctg-------------------tggagggcatgggtg----------
A0A513TZR1_E1B19K-      catttg-------------------tggagagcggtggtg----------
A0A516UYI9_E1B19K-      catctg-------------------tggagagcggtggtg----------
A0A516UYM9_E1B19K-      catctg-------------------tggagagcggtggtg----------
A0A5P8KYF0_E1B19K-      agctttg------------------tggagaacatggaag----------
A0A5P8KYF0_E1B19K-      ggccttatcagatgctgacctgcgctggtggacattgcaatattcttgct
                            *                    *** *  *   *             

A0A1Y1BYF1_E1B19K-      ---------------------aggcagcggg-------------gacaga
A0A513TZR1_E1B19K-      ---------------------agacacaaga-------------------
A0A516UYI9_E1B19K-      ---------------------agacacaaga-------------------
A0A516UYM9_E1B19K-      ---------------------agacacaaga-------------------
A0A5P8KYF0_E1B19K-      ---------------------gctcgcagga-------------tgagga
A0A5P8KYF0_E1B19K-      actgtgcatatcgtttcacatgcacgcaagaaatggcctgtatttgaaca
                                                *    *                    

A0A1Y1BYF1_E1B19K-      gaatcttgaacta-------------------------------------
A0A513TZR1_E1B19K-      ---------atcg-------------------------------------
A0A516UYI9_E1B19K-      ---------atcg-------------------------------------
A0A516UYM9_E1B19K-      ---------atcg-------------------------------------
A0A5P8KYF0_E1B19K-      caatcttaaatta-------------------------------------
A0A5P8KYF0_E1B19K-      taatgt--gattaccaagtgcaccatgcacataggtggtcgcaggggaat
                                 *                                        

A0A1Y1BYF1_E1B19K-      --------ctggcttatacagccagcag----------------------
A0A513TZR1_E1B19K-      --------catgctactgttgt----------------------------
A0A516UYI9_E1B19K-      --------cctgctactgttgt----------------------------
A0A516UYM9_E1B19K-      --------cctgctactgttgt----------------------------
A0A5P8KYF0_E1B19K-      --------ctggccagtgcagc----------------------------
A0A5P8KYF0_E1B19K-      gtttatgccttaccagtgtaacatgaatcatgtgaaggtaatgttggaac
                                *   *   *                                 

A0A1Y1BYF1_E1B19K-      ----------ctccgggtcttcttcgtc----------------------
A0A513TZR1_E1B19K-      ----------cttccg--tccgcccggcaat-------------------
A0A516UYI9_E1B19K-      ----------cttccg--tccgcccggcaat-------------------
A0A516UYM9_E1B19K-      ----------cttccg--tccgcccggcaat-------------------
A0A5P8KYF0_E1B19K-      ----------ctctag---gag--tagcagg-------------------
A0A5P8KYF0_E1B19K-      cagatgccttttccagagtgagcttaacaggaatctttgatatgaatatt
                                   *   *           *                      

A0A1Y1BYF1_E1B19K-      -----------tacacagacaaa--------------------------c
A0A513TZR1_E1B19K-      -----------aataccgacggagga------gcagcagcagcagcagca
A0A516UYI9_E1B19K-      -----------aataccgacggagg------------------------a
A0A516UYM9_E1B19K-      -----------aataccgacggaaga------gcagcagcagcagcagca
A0A5P8KYF0_E1B19K-      -----------gatactgagaca---------cccaccgaccatgccagc
A0A5P8KYF0_E1B19K-      caactatggaagatcctgagatatgatgacactaaaccgagggtgc--gc
                                    *  * **   *                           

A0A1Y1BYF1_E1B19K-      atccatgttggaggaaga---------------aatgaggca-----ggc
A0A513TZR1_E1B19K-      gcagcagcaggaggaagc---------------caggcggcggcggcggc
A0A516UYI9_E1B19K-      gcaacagcaggaggaagc---------------caggcggcggcggcggc
A0A516UYM9_E1B19K-      gcagcagcaggaggaagc---------------caggcggcggcggcggc
A0A5P8KYF0_E1B19K-      ggttctgcaggaggag-----------------cagcaggag--------
A0A5P8KYF0_E1B19K-      gcatgcgaatgcggaggcaagcatgctagattccagccggtgtgcgtgga
                              *   * ***                   *   **          

A0A1Y1BYF1_E1B19K-      catggacga-------gaacccgaggagcg--------------gcctgg
A0A513TZR1_E1B19K-      aggagcagagcccatggaacccgagagccg--------------gcctgg
A0A516UYI9_E1B19K-      aggagcagagcccatggaacccgagagccg--------------gcctgg
A0A516UYM9_E1B19K-      aggagcagagcccatggaacccgagagccg--------------gcctgg
A0A5P8KYF0_E1B19K-      -------ga-------caatccgagagccg--------------gcctgg
A0A5P8KYF0_E1B19K-      tgtgactga-------agacctgagacccgatcatttggtgcttgcctgc
                               **         * * ***   **              ***** 

A0A1Y1BYF1_E1B19K-      acc--------------ctccgtcggaagaggagctgaattga
A0A513TZR1_E1B19K-      acc--------------ctcgggaa---------------tga
A0A516UYI9_E1B19K-      acc--------------ctcgggaa---------------tga
A0A516UYM9_E1B19K-      acc--------------ctcgggaa---------------tga
A0A5P8KYF0_E1B19K-      acc--------------ctccggtggaggag---------tag
A0A5P8KYF0_E1B19K-      actggagcggagttcggttccagtggtgaagaaactg-actaa
                        **                **                    *  

© 1998-2020Legal notice