Dataset for CDS E1B19K of organism Human adenovirus F serotype 40

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A142G3J2_E1B19K-      atggagttgtggagtgagttacaaagttatcaaaacctccgacgcttgct
P10543_E1B19K-01        atggagttgtggagtgagttacaaagttatcagaacctccgacgcttgct
                        ******************************** *****************

A0A142G3J2_E1B19K-      ggagttggcttctgccagaacttccagctgttggagaatcctttttggct
P10543_E1B19K-01        ggagttggcttctgccagaacttccagctgttggagaatcctttttggct

A0A142G3J2_E1B19K-      caactttagctaatgtgatttatagagctaaggaggagtactcttcgcgg
P10543_E1B19K-01        caactttaactaatgtaatctatagagctaaggaggagtactcttcgcgg
                        ******** ******* ** ******************************

A0A142G3J2_E1B19K-      tttgctgaccttttgtcgcataaccctggaatttttgcttctttgaattt
P10543_E1B19K-01        tttgctgaccttttgtcgcataaccctggaatttttgcttctttgaattt

A0A142G3J2_E1B19K-      ggggcatcactcattttttcaagaaattgtgatcagaaatttagattttt
P10543_E1B19K-01        ggggcatcactcattttttcaagaaattgtgatcagaaatttagattttt

A0A142G3J2_E1B19K-      cttctcctggccgtacggtttctgggcttgcttttatttgttttatattg
P10543_E1B19K-01        cttctcctggccgtacggtttctgggcttgcttttatttgttttatattg

A0A142G3J2_E1B19K-      gatcaatggagcgcccaaactcatctgtcgcagggttatactctggatta
P10543_E1B19K-01        gatcaatggagcgcccaaactcatctgtcgcagggttatactctggatta

A0A142G3J2_E1B19K-      catggcaatggctctgtggagaaccttgctacggaggaagagggtcttag
P10543_E1B19K-01        catggcaatggctctgtggagaaccttgctacggaggaagagggtcttag

A0A142G3J2_E1B19K-      gttgcttgccggcgcagcgtccgcacggtttggatccagtgcaggaagag
P10543_E1B19K-01        gttgcttgccggcgcagcgtccgcacggtttggatccagtgcaggaagag

A0A142G3J2_E1B19K-      gaggaggaggaggagaacctgagggccggcctggacccttcaacggaatt
P10543_E1B19K-01        gaggaggaggaggagaacctgagggccggcctggacccttcaacggaatt

A0A142G3J2_E1B19K-      gtaa
P10543_E1B19K-01        gtaa

© 1998-2020Legal notice