Dataset for CDS E1B19K of organism Human adenovirus E serotype 4

[Download (right click)] [Edit] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

P10406_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC7_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC8_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC7_E1B19K-02        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q2KSM8_E1B19K-02        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSG6_E1B19K-01        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSM8_E1B19K-01        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A3G8W6L2_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSG6_E1B19K-02        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        agagaacgcctcgaacggagtctctcacctgtggagattctgcttcggcg
Q5GFC7_E1B19K-01        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q5GFC8_E1B19K-01        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q5GFC7_E1B19K-02        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q2KSM8_E1B19K-02        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSG6_E1B19K-01        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSM8_E1B19K-01        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A3G8W6L2_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSG6_E1B19K-02        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC7_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC8_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC7_E1B19K-02        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q2KSM8_E1B19K-02        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSG6_E1B19K-01        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSM8_E1B19K-01        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A3G8W6L2_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSG6_E1B19K-02        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        tttgaggatattttgagagagtgtcctagtctttttgacgctcttaactt
Q5GFC7_E1B19K-01        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q5GFC8_E1B19K-01        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q5GFC7_E1B19K-02        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q2KSM8_E1B19K-02        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSG6_E1B19K-01        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSM8_E1B19K-01        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A3G8W6L2_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSG6_E1B19K-02        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC7_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC8_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC7_E1B19K-02        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSM8_E1B19K-02        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSG6_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSM8_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A3G8W6L2_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSG6_E1B19K-02        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC7_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC8_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC7_E1B19K-02        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q2KSM8_E1B19K-02        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSG6_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSM8_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A3G8W6L2_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSG6_E1B19K-02        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        --------------------------------------------------
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        --------------------------------------------------
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        --------------------------------------------------
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC8_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-02        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q2KSM8_E1B19K-02        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSM8_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A3G8W6L2_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-02        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q5GFC7_E1B19K-05        -----atggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-03        -----atggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-04        -----atggagtcaagaaacccatttcagcagggattaccagctggattt
Q2KSG6_E1B19K-05        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSM8_E1B19K-05        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSM8_E1B19K-03        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSM8_E1B19K-04        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-03        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-04        -----atggagtcaagaaacccatttcagcagggattaccagttggattt
                             ************************************* *******

P10406_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC8_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-02        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-02        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-01        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-01        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A3G8W6L2_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-02        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-05        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-03        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-04        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-05        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-05        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-03        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSM8_E1B19K-04        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-03        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-04        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
                        ********************** ***************************

P10406_E1B19K-01        tc-ccggctacttgccggtacagccgctag--------------------
Q5GFC7_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
Q5GFC8_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
Q5GFC7_E1B19K-02        tc-ccggctacttgccggtacagccgctag--------------------
Q2KSM8_E1B19K-02        tc-ccggctacttgccggtacagccgctag--------------------
Q2KSG6_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSM8_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
A0A3G8W6L2_E1B19K-      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSG6_E1B19K-02        tc----------tgccggtacagccgctag--------------------
Q5GFC7_E1B19K-05        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
Q5GFC7_E1B19K-03        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
Q5GFC7_E1B19K-04        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
Q2KSG6_E1B19K-05        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSM8_E1B19K-05        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSM8_E1B19K-03        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSM8_E1B19K-04        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSG6_E1B19K-03        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSG6_E1B19K-04        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
                        **          ******************                    

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        ctc---------------------------------cagcagcaggagga
Q5GFC8_E1B19K-01        ctc---------------------------------cagcagcaggagga
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSM8_E1B19K-01        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
A0A3G8W6L2_E1B19K-      ctccagcaaatttcccaggaacgccaacgccgccagcggcagcaggagga
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        ctc---------------------------------cagcagcaggagga
Q5GFC7_E1B19K-03        ctc---------------------------------cagcagcaggagga
Q5GFC7_E1B19K-04        ctc---------------------------------cagcagcaggagga
Q2KSG6_E1B19K-05        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSM8_E1B19K-05        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSM8_E1B19K-03        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSM8_E1B19K-04        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSG6_E1B19K-03        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
Q2KSG6_E1B19K-04        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg
Q5GFC8_E1B19K-01        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg
Q2KSM8_E1B19K-01        tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
A0A3G8W6L2_E1B19K-      tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg
Q5GFC7_E1B19K-03        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg
Q5GFC7_E1B19K-04        tcaagaagagaatccgagagccggcctggaccctccggc------ggagg
Q2KSG6_E1B19K-05        tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg
Q2KSM8_E1B19K-05        tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSM8_E1B19K-03        tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSM8_E1B19K-04        tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSG6_E1B19K-03        tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg
Q2KSG6_E1B19K-04        tcaagaagagaacccgagagccggcctggaccctccggc---ggaggagg

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        agtag---------------------------------------------
Q5GFC8_E1B19K-01        agtag---------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        agtag---------------------------------------------
Q2KSM8_E1B19K-01        agtag---------------------------------------------
A0A3G8W6L2_E1B19K-      agtag---------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        agtagctgacctg-------------------------------------
Q5GFC7_E1B19K-03        agtagctgacctgtttcctgaactgcaccgggtgctgactaggtcttcga
Q5GFC7_E1B19K-04        agtagctgacctgtttcctgaactgcaccgggtgctgactagg-------
Q2KSG6_E1B19K-05        agtagctgacctg-------------------------------------
Q2KSM8_E1B19K-05        agtagctgacctg-------------------------------------
Q2KSM8_E1B19K-03        agtagctgacctgtttcctgaactgcgccgggtgctgactaggtctttga
Q2KSM8_E1B19K-04        agtagctgacctgtttcctgaactgcgccgggtgctgact----------
Q2KSG6_E1B19K-03        agtagctgacctgtttcctgaactgcgccgggtgctgactaggtctttga
Q2KSG6_E1B19K-04        agtagctgacctgtttcctgaactgcgccgggtgctgactagg-------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gtggtcgggagaggggtattaagcgggagaggcatgatgagactaatcac
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gtggtcgggagaggggtattaagcgggagaggcatgatgagactaatcat
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gtggtcgggagaggggtattaagcgggagaggcatgatgagactaatcat
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        agaattgaactgactgtgggtctgatgagccgcaagcgtccagaaacagt
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        agaactgaactaactgtgggtctaatgagccgcaagcgtccagaaacagt
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        agaactgaactaactgtgggtctaatgagccgcaagcgtccagaaacagt
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gtggtggtatgaggtgcagtcaactggcacagatgaggtgtcagtcatgc
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gtggtggcatgaggtgcagttgactggcacagatgaggtgtcagtcatgc
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gtggtggcatgaggtgcagatgactggcacagatgaggtgtcagtcatgc
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        atgagagattttccctagaacaagtcaagacttgttggttggagcctgag
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        atgagaaattttccctagaacaagttaaaacttgttggttggagcctgag
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        atgagaaattttccctagaacaagttaaaacttgttggttggagcctgag
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gatgattgggaggtagccatcaggaattatgccaagctggctctgaggcc
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gatgattgggaggtagccatcaggaattatgctaagctggctctaaggcc
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gatgattgggaggtagccatcaggaattatgctaagctggctctaaggcc
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        agatagaaagtacaagattactaagctgataaatatcagaaatgcctgct
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        agatagaaagtacaagattactaagcttataaatatcagaaatgcctgct
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        agatagaaagtacaagattactaagcttataaatatcagaaatgcctgct
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        acatctcagggaatggggctgaagtggagatctgtctccaggatagagtg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        acatctcagggaatggggctgaagtggagatctgtccgcaggatagagtg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        acatctcagggaatggggctgaagtggagatctgtccgcaggatagagtg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gctttcagatgctgcatgatgaatatgtacccgggagtggtggacatgga
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gctttcagatgctgcatgatgaatatgtacccgggggtggtggacatgga
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gctttcagatgctgcatgatgaatatgtacccgggggtggtggacatgga
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        tggggtcacctttatgaacatgaggttcaggggagatgggtataatggga
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        tggggtcacctttatgaacattaggtttaggggagatgggtataatggga
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        tggggtcacctttatgaacattaggtttaggggagatgggtataatggga
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        cggtctttatggccaataccaagctgacagtgcatggatgctccttcttt
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        cggtctttatggccaataccaagctgacagtgcatggctgctccttcttt
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        cggtc---atggccaataccaagctgacagtgcatggctgctccttcttt
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gggtttaataacacctgcatcgaggcttggggtcaggtcggtgttaaggg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gggtttaataacacctgcattgaggcctggggtcatgtcggagtaagggg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gggtttaataacacctgcattgaggcctggggtcatgtcggagtaagggg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gtgcagtttttcagccaactggatgggggtagtgggcaggaccaagagta
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gtgcagtttttcagccaactggatgggggtagtgggcaggaccaagagta
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gtgcagtttttcagccaactggatgggggtagtgggcaggaccaagagta
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        tgctgtctgtgaagaaatgcttgtttgagaggtgccacctgggggtgatg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        tgctgtctgtgaaaaaatgcttgtttgagaggtgccatctgggggtgatg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        tgctgtctgtgaaaaaatgcttgtttgagaggtgccatctgggggtgatg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        agcgagggcgaagccagaatccgccactgtgcctctaccgagacgggctg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        agcgagggcgaagccagaatccgccactgtgcctctaccgagacgggctg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        agcgagggcgaagccagaatccgccactgtgcctctaccgagacgggctg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        ttttgtgctgtgcaagggcaatgccaagatcaagcataatatgatctgtg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        ttttgtgctgtgcaagggcaatgccaagattaagcataatatgatctgtg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        ttttgtgctgtgcaagggcaatgccaagattaagcataatatgatctgtg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gagcctcggacgagcgcggctaccagatgctgacctgcgccggtgggaac
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gagcctcggacgagcgcggctaccaaatgctaacatgcgccggtgggaac
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gagcctcggacgagcgcggctaccaaatgctaacatgcgccggtgggaac
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        agtcatatgctggccgccgtgcatgtggcttcccattcccgcaagccctg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        agtcatatgctggccaccgtgcatgtggcttcgcatccccgcaagccctg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        agtcatatgctggccaccgtgcatgtggcttcgcatccccgcaagccctg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gcctgagttcgagcacaatgtcatgaccaggtgcaatatgcatctggggg
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gcctgagtttgagcacaatgtcatgaccaggtgcaatatgcatctggggg
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        gcctgagtttgagcacaatgtcatgaccaggtgcaatatgcatctggggg
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        ctcgccgaggcatgtttatgccctaccagtgcaacctgaattatgtaaag
Q5GFC7_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        ctcgccgaggcatgttaatgctctaccagtgcaacctgaattatgtgaag
Q2KSM8_E1B19K-04        --------------------------------------------------
Q2KSG6_E1B19K-03        ctcgccgaggcatgttaatgctctaccagtgcaacctgaattatgtgaag
Q2KSG6_E1B19K-04        --------------------------------------------------

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        gtgctcctggagcccgatgtcatgtccagagtgagcctgacgggggtgtt
Q5GFC7_E1B19K-04        ------------------------------gtgagcctgacgggggtgtt
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        gtgctcttggagcccgatgccatgtccagagtaagcctgacgggggtgtt
Q2KSM8_E1B19K-04        ---------------------------agagtaagcctgacgggggtgtt
Q2KSG6_E1B19K-03        gtgctcttggagcccgatgccatgtccagagtaagcctgacgggggtgtt
Q2KSG6_E1B19K-04        ------------------------------gtaagcctgacgggggtgtt

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        --------------------------------------------------
Q5GFC7_E1B19K-03        tgacatgaatgtggaagtgtggaagattctaagatatgatgaatacaaga
Q5GFC7_E1B19K-04        tgacatgaatgtggaagtgtggaagattctaagatatgatgaatacaaga
Q2KSG6_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-05        --------------------------------------------------
Q2KSM8_E1B19K-03        tgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaaga
Q2KSM8_E1B19K-04        tgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaaga
Q2KSG6_E1B19K-03        tgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaaga
Q2KSG6_E1B19K-04        tgacatgaatgtggaagtgtggaaaattttaagatatgatgaatacaaga

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        ------------------------------------------------cc
Q5GFC7_E1B19K-03        ccaggtgtcgagcctgcgagtgcggagggaagcatgccaggttccagccc
Q5GFC7_E1B19K-04        ccaggtgtcgagcctgcgagtgcggagggaagcatgccaggttccagccc
Q2KSG6_E1B19K-05        ------------------------------------------------cc
Q2KSM8_E1B19K-05        ------------------------------------------------cc
Q2KSM8_E1B19K-03        ccaggtgccgagcctgcgagtgcggagggaagcatgccaggttccagccc
Q2KSM8_E1B19K-04        ccaggtgccgagcctgcgagtgcggagggaagcatgccaggttccagccc
Q2KSG6_E1B19K-03        ccaggtgccgagcctgcgagtgcggagggaagcatgccaggttccagccc
Q2KSG6_E1B19K-04        ccaggtgccgagcctgcgagtgcggagggaagcatgccaggttccagccc

P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-02        --------------------------------------------------
Q2KSM8_E1B19K-02        --------------------------------------------------
Q2KSG6_E1B19K-01        --------------------------------------------------
Q2KSM8_E1B19K-01        --------------------------------------------------
A0A3G8W6L2_E1B19K-      --------------------------------------------------
Q2KSG6_E1B19K-02        --------------------------------------------------
Q5GFC7_E1B19K-05        gtgtgtgtggatgtga----------------------------------
Q5GFC7_E1B19K-03        gtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtc
Q5GFC7_E1B19K-04        gtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtc
Q2KSG6_E1B19K-05        gtgtgtgtga----------------------------------------
Q2KSM8_E1B19K-05        gtgtgtgtggatgtga----------------------------------
Q2KSM8_E1B19K-03        gtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtc
Q2KSM8_E1B19K-04        gtgtgtgtggatgtgacggaggacctgcgacccgatcatttggtgttgtc
Q2KSG6_E1B19K-03        gtgtgtgtgaatgtgacggaggacctgcgacccgatcatttggtgttgtc
Q2KSG6_E1B19K-04        gtgtgtgtgaatgtgacggaggacctgcgacccgatcatttggtgttgtc

P10406_E1B19K-01        ----------------------------------------------
Q5GFC7_E1B19K-01        ----------------------------------------------
Q5GFC8_E1B19K-01        ----------------------------------------------
Q5GFC7_E1B19K-02        ----------------------------------------------
Q2KSM8_E1B19K-02        ----------------------------------------------
Q2KSG6_E1B19K-01        ----------------------------------------------
Q2KSM8_E1B19K-01        ----------------------------------------------
A0A3G8W6L2_E1B19K-      ----------------------------------------------
Q2KSG6_E1B19K-02        ----------------------------------------------
Q5GFC7_E1B19K-05        ----------------------------------------------
Q5GFC7_E1B19K-03        ctgcaccgggacggagttcggctccagtggggaagaatctgactag
Q5GFC7_E1B19K-04        ctgcaccgggacggagttcggctccagtggggaagaatctgactag
Q2KSG6_E1B19K-05        ----------------------------------------------
Q2KSM8_E1B19K-05        ----------------------------------------------
Q2KSM8_E1B19K-03        ctgcaccgggacggagtttggctccagcggggaagaatctgactag
Q2KSM8_E1B19K-04        ctgcaccgggacggagtttggctccagcggggaagaatctgactag
Q2KSG6_E1B19K-03        ctgcaccgggacggagtttggctccagcggggaagaatctgactag
Q2KSG6_E1B19K-04        ctgcaccgggacggagtttggctccagcggggaagaatctgactag

© 1998-2022Legal notice