Dataset for CDS E1B19K of organism Human adenovirus E serotype 4

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q2KSM8_E1B19K-01        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
A0A3G8W6L2_E1B19K-      atggagatttggacggtcttggaagacttttacaagactaggcagctgct
Q2KSG6_E1B19K-01        atggagatttggacggtcttggaagacttttacaagactaggcagctgct
P10406_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC7_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
Q5GFC8_E1B19K-01        atggagatttggacggttttggaagactttcacaagactaggcagctgct
                        ***************** ************ *******************

Q2KSM8_E1B19K-01        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
A0A3G8W6L2_E1B19K-      agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
Q2KSG6_E1B19K-01        agagaacgcctcgaacggagtttcttacctgtggagattttgcttcggtg
P10406_E1B19K-01        agagaacgcctcgaacggagtctctcacctgtggagattctgcttcggcg
Q5GFC7_E1B19K-01        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
Q5GFC8_E1B19K-01        agagaacgcctcgaacggagtctcttacctgtggagattctgcttcggcg
                        ********************* *** ************* ******** *

Q2KSM8_E1B19K-01        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
A0A3G8W6L2_E1B19K-      gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
Q2KSG6_E1B19K-01        gcgacctagctaagctagtctataggaccaaacaggattataaggaacaa
P10406_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC7_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
Q5GFC8_E1B19K-01        gtgacctagctaagctagtctatagggccaaacaggattatagggaacaa
                        * ************************ *************** *******

Q2KSM8_E1B19K-01        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
A0A3G8W6L2_E1B19K-      tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
Q2KSG6_E1B19K-01        tttgatgatattttaaaagagtgtcctggtctttttgacgctcttaactt
P10406_E1B19K-01        tttgaggatattttgagagagtgtcctagtctttttgacgctcttaactt
Q5GFC7_E1B19K-01        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
Q5GFC8_E1B19K-01        tttgaggatattttgagagagtgtcctggtctttttgacgctcttaactt
                        ***** ******** * ********** **********************

Q2KSM8_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
A0A3G8W6L2_E1B19K-      gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q2KSG6_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
P10406_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC7_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta
Q5GFC8_E1B19K-01        gggccatcagtctcactttaaccagagaatttcaagagcccttgacttta

Q2KSM8_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
A0A3G8W6L2_E1B19K-      ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
Q2KSG6_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttgttctt
P10406_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC7_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
Q5GFC8_E1B19K-01        ctactcctggcagaaccactgcagcagtagccttttttgcttttattttt
                        ******************************************** ** **

Q2KSM8_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
A0A3G8W6L2_E1B19K-      gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
Q2KSG6_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagttggattt
P10406_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC7_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
Q5GFC8_E1B19K-01        gacaaatggagtcaagaaacccatttcagcagggattaccagctggattt
                        ****************************************** *******

Q2KSM8_E1B19K-01        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
A0A3G8W6L2_E1B19K-      cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
Q2KSG6_E1B19K-01        cttagcagtagctttgtggagagcatggaagtgccagcgcctgaatgcaa
P10406_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC7_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
Q5GFC8_E1B19K-01        cttagcagtagctttgtggagaacatggaagtgccagcgcctgaatgcaa
                        ********************** ***************************

Q2KSM8_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
A0A3G8W6L2_E1B19K-      tctccggctacttgccggtacagccgctagacactctgaggatcctaagt
Q2KSG6_E1B19K-01        tc----------tgccggtacagccgctag--------------------
P10406_E1B19K-01        tc-ccggctacttgccggtacagccgctag--------------------
Q5GFC7_E1B19K-01        tc-ccggctacttgccggtacagccgctag--------------------
Q5GFC8_E1B19K-01        tctccggctacttgccggtacagccgctagacactctgaggatcctgagt
                        **          ******************                    

Q2KSM8_E1B19K-01        ctccagcaaatttcccaggaacgccaacgccgccagcagcagcaggagga
A0A3G8W6L2_E1B19K-      ctccagcaaatttcccaggaacgccaacgccgccagcggcagcaggagga
Q2KSG6_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        ctcca---------------------------------gcagcaggagga

Q2KSM8_E1B19K-01        tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
A0A3G8W6L2_E1B19K-      tcaagaagagaacccgagagccggcctggaccctccggcggaggaggagg
Q2KSG6_E1B19K-01        --------------------------------------------------
P10406_E1B19K-01        --------------------------------------------------
Q5GFC7_E1B19K-01        --------------------------------------------------
Q5GFC8_E1B19K-01        tcaagaagagaatccgagagccggcctggaccctccggcggaggagtag-

Q2KSM8_E1B19K-01        agtag
A0A3G8W6L2_E1B19K-      agtag
Q2KSG6_E1B19K-01        -----
P10406_E1B19K-01        -----
Q5GFC7_E1B19K-01        -----
Q5GFC8_E1B19K-01        -----

© 1998-2020Legal notice