Dataset for CDS adenoviridae of organism Human adenovirus D13

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


M0QU02_E1B19K-01      atggatgtgtggactatccttgcggactttaacaagacacgccggcttgt
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      agaggatagttcagacgggtgctccggtttctggagacactggtttggaa
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      ctcctctatctcgcctggtgtacacagtaaagaaggattatcaggaggaa
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      tttgaaaatctttttgctgactgctctggcctgcttgattctctgaattt
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      cggccaccagtcccttttccaggaaagggtcctccacagccttgattttt
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      ccagcccagggcgcactacagccggggttgcatttgtggtttttctggtt
M0QU02_E1B19K-02      --------------------------------------------------
                                                                        

M0QU02_E1B19K-01      gacaaatggagccaggacacccaactgagcaggggctacatcctggactt
M0QU02_E1B19K-02      -----atggagccaggacacccaactgagcaggggctacatcctggactt
                           *********************************************

M0QU02_E1B19K-01      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
M0QU02_E1B19K-02      cgcagccatgcacctgtggagggcctggatcaggcagcggggacagagaa
                      **************************************************

M0QU02_E1B19K-01      tcttgaactactggcttctacagccagcagctccgggtcttcttcatcta
M0QU02_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcatcta
                      **************************************************

M0QU02_E1B19K-01      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacga
M0QU02_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacga
                      **************************************************

M0QU02_E1B19K-01      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattga-
M0QU02_E1B19K-02      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattgaa
                      ************************************************* 

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      tcaggtatccagcctatacccagagcttagcagggtcctgaccaacggat
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      ccataggtgcgaggggagtgaagagggagaggagcgatggtggcaatacc
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gggatgatgaccgagctgactgccagcctgatgaatcgcaagcgcccaga
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gtgcattacctggcatgagctacagatggagtgcagggatgaggtgggcc
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      tgatgcaggataaatatggcctggagcagataaaaactcactggttgaac
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      ccagatgaggattgggaggaggccattaagaagtatgctaagatagccct
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gcgcccagattgcaagtacaggatcactaagacggtgaatatcagacatg
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      cctgctacatctcagggaatggggcagaggtggtcatcgataccctggac
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      aagtctgccttcaggtgttgcatgatgggaatgagagccggtgtgatgaa
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      tatgaattccatgatcttcatgaacatgaagtttaatggagagaagttta
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      acggggtgctgttcatggccaacagccatatgaccctgcatggctgcaag
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      ttcttcggattcaacaatatgtgtgcagaggtgtggggctcagccaagat
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      caggggctgtgtgtattatggttgctggatgggcgtggtcggaagaccca
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      agagcgagatgtctgtaaagcagtgtgtgtttgagaagtgctacctggga
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gtctctaccgagggcaatgctcgggtgagacactgttcttccatcgagac
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gggctgcttctgcctggtgaagggcacagcctcgctcaagcataatgtga
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      tcaaggggtgcacggatgagcgcatgtacaacatgctgacctgcgactcg
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      ggtgtctgccatatcctgaagaacatccatatcacctcccacgctagaaa
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gaagtggccagtgtttgagaataacatgctgatcaagtgccatgtgcacc
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      tgggtgtcagaaggggcaccttccagccgtaccagtgcaactttagccag
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      accaagctgctgctggagagcgatgccttctccagggtgaacctgaacgg
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      catctttgacatggatgtctcggtgtacaagatcctgagatacgatgaga
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      ccaggtccagggtgcgcgcttgcgagtgcggaggcagacacaccaggatg
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      caaccagtggccctggatgtgaccgaggagctgaggcccgaccacctggt
                                                                        

M0QU02_E1B19K-01      --------------------------------------------------
M0QU02_E1B19K-02      gatggcctgtaccgggaccgagttcagctccagcggggaggacacagatt
                                                                        

M0QU02_E1B19K-01      --
M0QU02_E1B19K-02      ag
                        

© 1998-2020Legal notice