Dataset for CDS E1B19K of organism Human adenovirus D serotype 8

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1P7YYY5_E1B19K-      atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt
A0A1P7YWY2_E1B19K-      atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt
A0A1P7YWR9_E1B19K-      atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt
A0A1P7YXN8_E1B19K-      atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt
A0A1P8C849_E1B19K-      atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt
B9A5A7_E1B19K-01        atggatgtgtggagtattcttggggaatttaacaagacacgccggcttgt

A0A1P7YYY5_E1B19K-      ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa
A0A1P7YWY2_E1B19K-      ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa
A0A1P7YWR9_E1B19K-      ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa
A0A1P7YXN8_E1B19K-      ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa
A0A1P8C849_E1B19K-      ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa
B9A5A7_E1B19K-01        ggaggatagttcagacgggtgctccgggttttggagacactggtttggaa

A0A1P7YYY5_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa
A0A1P7YWY2_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa
A0A1P7YWR9_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa
A0A1P7YXN8_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa
A0A1P8C849_E1B19K-      ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa
B9A5A7_E1B19K-01        ctcctctatctcgcctggtgtacacagttaagaaggattatagcgaggaa

A0A1P7YYY5_E1B19K-      tttgaaaatctttttgccgactgctctggcctgctagattctttaaattt
A0A1P7YWY2_E1B19K-      tttgaaaatatttttgccgactgctcttgcctgctagattctttaaattt
A0A1P7YWR9_E1B19K-      tttgaaaatatttttgccgactgctctggcctgctagattctttaaattt
A0A1P7YXN8_E1B19K-      tttgaaaatatttttgccgactgctcttgcctgctagattctttaaattt
A0A1P8C849_E1B19K-      tttgaaaatctttttgccgactgctctggcctgctagattctttaaattt
B9A5A7_E1B19K-01        tttgaaaatctttttgccgactgctctggcctgctagattctttaaattt
                        ********* ***************** **********************

A0A1P7YYY5_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
A0A1P7YWY2_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
A0A1P7YWR9_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
A0A1P7YXN8_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
A0A1P8C849_E1B19K-      tggccaccagtcccttttccaggaaagggtactccacagccttgattttt
B9A5A7_E1B19K-01        tggccaccagtcccttttccaggaaagggtactccacagccttgattttt

A0A1P7YYY5_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt
A0A1P7YWY2_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt
A0A1P7YWR9_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt
A0A1P7YXN8_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt
A0A1P8C849_E1B19K-      ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt
B9A5A7_E1B19K-01        ccagcccagggcgcactacagccggggttgcttttgtggtttttttggtt

A0A1P7YYY5_E1B19K-      gacaaatggagccaggacacccaactaagcaggggctacattctggactt
A0A1P7YWY2_E1B19K-      gacaaatggagccaggacacccaactaagcaggggctacattctggactt
A0A1P7YWR9_E1B19K-      gacaaatggagccaggacacccaactaagcaggggctacattctggactt
A0A1P7YXN8_E1B19K-      gacaaatggagccaggacacccaactaagcaggggctacattctggactt
A0A1P8C849_E1B19K-      gacaaatggagccaggacacccaactaagcaggggctacattctggactt
B9A5A7_E1B19K-01        gacaaatggagccaggacacccaactaagcaggggctacattctggactt

A0A1P7YYY5_E1B19K-      tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa
A0A1P7YWY2_E1B19K-      tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa
A0A1P7YWR9_E1B19K-      tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa
A0A1P7YXN8_E1B19K-      tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa
A0A1P8C849_E1B19K-      tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa
B9A5A7_E1B19K-01        tgcagccatgcacctgtggagggcctggatgaggcagcggggacagagaa

A0A1P7YYY5_E1B19K-      tcttgaactactggcttctacagccagcagcttcgggtcttcttcatcta
A0A1P7YWY2_E1B19K-      tcttgaactactggcttctacagccagcagcttcgggtcttcttcatcta
A0A1P7YWR9_E1B19K-      tcttgaactactggcttctacagccagcagcttcgggtcttcttcatcta
A0A1P7YXN8_E1B19K-      tcttgaactactggcttctacagccagcagcttcgggtcttcttcatcta
A0A1P8C849_E1B19K-      tcttgaactactggcttctacagccagcagctttgggtcttcttcatcta
B9A5A7_E1B19K-01        tcttgaactactggcttctacagccagcagcttcgggtcttcttcatcta
                        ********************************* ****************

A0A1P7YYY5_E1B19K-      cacagacaaacatccatgttggaggaagaaataagggaggccatggacaa
A0A1P7YWY2_E1B19K-      cacagacaaacatccatgttggaggaagaaatgagggagtccatggacaa
A0A1P7YWR9_E1B19K-      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacaa
A0A1P7YXN8_E1B19K-      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacaa
A0A1P8C849_E1B19K-      cacagacaaacatccatgttggaggaagaaatgagggaggccatggacaa
B9A5A7_E1B19K-01        cacagacaaacatccatgttggaggaagaaatgagggaggccatggacaa
                        ******************************** ****** **********

A0A1P7YYY5_E1B19K-      gaacccgaggagcggcctggaccctccgttggaagaggagctggattaa
A0A1P7YWY2_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattaa
A0A1P7YWR9_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattaa
A0A1P7YXN8_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattaa
A0A1P8C849_E1B19K-      gaacccgaggagcggcctggaccctccgtcggaagaggagctggattaa
B9A5A7_E1B19K-01        gaacccgaggagcggcctggaccctccgtcggaagaggagctggattaa
                        ***************************** *******************

© 1998-2020Legal notice