Dataset for CDS adenoviridae of organism Human adenovirus D serotype 17

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F1DT57_E1B19K-01      atggat-----------------gtgtggactatccttgcagactttagc
F1DT57_E1B19K-02      atggagccagaacacccaactgagcaggggcta-cattctggacttcg--
                      *****                  *   ** *** * **   *****    

F1DT57_E1B19K-01      aagacacgccggcttgtagagg--atagttcagacgggt-----------
F1DT57_E1B19K-02      cagccatgc--acctgtggagggcatgggtcaggcagcggggacagagaa
                       ** ** **   * *** ****  ** * **** * *             

F1DT57_E1B19K-01      -----------------------------gctccgggttct---------
F1DT57_E1B19K-02      tcttgaactactggcttctacagccagcagctccgggtcttcttcgtcta
                                                   *********  *         

F1DT57_E1B19K-01      ------------------------ggagacac------------------
F1DT57_E1B19K-02      cacagacaaacatccatgttggaggaagaaatgaggcaggccatggacga
                                              * *** *                   

F1DT57_E1B19K-01      ------------tggtttggaactcct-----------------------
F1DT57_E1B19K-02      gaacccgaggagcggtctggaccctccgtcggaagaggagttggattgaa
                                   *** **** *  *                        

F1DT57_E1B19K-01      ----ctatctcgcct------------------ggtgtacac--------
F1DT57_E1B19K-02      tcaggtatccagcctgtacccagagcttagcaaggtgctgacatccatgg
                           ****  ****                  ****   **        

F1DT57_E1B19K-01      -------agttaaaa-----------------------------------
F1DT57_E1B19K-02      ccaggggagtgaagagggagaggagcgatgggggcaataccgggatgatg
                             *** ** *                                   

F1DT57_E1B19K-01      --------------------------------------------------
F1DT57_E1B19K-02      accgagctgacggccagtctgatgaatcgcaagcgcccagagcgccttac

F1DT57_E1B19K-01      -----------------aggattataacgaggaatt--------------
F1DT57_E1B19K-02      ctggtacgagctacagcaggagtgcagggatgagttgggcctgatgcagg
                                       **** *  *  ** ** **              

F1DT57_E1B19K-01      ---------------------tgaaaatctttttgct-------------
F1DT57_E1B19K-02      ataaatatggcctggagcagataaaaacccattggttgaacccagatgag
                                           * **** *  ** * *             

F1DT57_E1B19K-01      --------------------------------gattgctctg--------
F1DT57_E1B19K-02      gattgggaggaggctattaagaagtatgccaagatagccctgcgcccaga
                                                      *** ** ***        

F1DT57_E1B19K-01      ----------------------------------------gcctgcta--
F1DT57_E1B19K-02      ttgcaagtacatagtgaccaagaccgtgaatatcagacatgcctgctaca

F1DT57_E1B19K-01      -----------------------------gattctctgaatctcggccac
F1DT57_E1B19K-02      tctcggggaacggggcagaggtggtcattgataccctgga-caaggccgc
                                                   *** * *** * *  **** *

F1DT57_E1B19K-01      c---------------------------------------------agtc
F1DT57_E1B19K-02      ctttaggtgttgcatgatgggaatgagagccggagtgatgaatatgaatt
                      *                                             * * 

F1DT57_E1B19K-01      cctt-------------------ttccaggaa------------agggta
F1DT57_E1B19K-02      ccatgatctttatgaacatgaagttcaatggagagaagtttaatggggtg
                      ** *                   *** * * *             **** 

F1DT57_E1B19K-01      ct---------------ccaca------------gccttgatttttccag
F1DT57_E1B19K-02      ctgttcatggccaacagccacatgaccctgcatggctgcgactttttcgg
                      **               *****            **   ** **** * *

F1DT57_E1B19K-01      cccagg------gcgcactacagccggggttgcttt-------------t
F1DT57_E1B19K-02      ctttaacaatatgtgcgcagaggtctggggcgcttccaagatcaggggat
                      *           * ** *    * * ***  ****              *

F1DT57_E1B19K-01      gtggtttttctggttgacaaatgg----agccagaacacccaa-------
F1DT57_E1B19K-02      gtaagttttatggctgctggatgggcgtggtcggaagacccaagagcgag
                      **   **** *** **    ****     * * *** ******       

F1DT57_E1B19K-01      --------------------------------------------------
F1DT57_E1B19K-02      atgtctgtgaagcagtgtgtgtttgagaaatgctacctgggagtctctac

F1DT57_E1B19K-01      ----------------------------------ctgagcaggggct---
F1DT57_E1B19K-02      cgagggcaatgctagagtgaggcactgctcttccctggagacgggctgct
                                                        ***   * *****   

F1DT57_E1B19K-01      --------------------------------------------------
F1DT57_E1B19K-02      tctgcctggtgaagggcacagcctctctgaagcataatatggtgaagggc

F1DT57_E1B19K-01      ----------------------acattctggacttcg-------------
F1DT57_E1B19K-02      tgcacggatgagcgcatgtacaacatgctgacctgcgactcgggggtctg
                                            **** ***  ** **             

F1DT57_E1B19K-01      ---------------cagccatg--------cacc---------------
F1DT57_E1B19K-02      tcatatcctgaagaacatccatgtgacctcccaccccagaaagaagtggc
                                     ** *****        ****               

F1DT57_E1B19K-01      -------tgtggagggcatg--ggtcagg---------------------
F1DT57_E1B19K-02      cagtgtttgagaataacatgctgatcaagtgccacatgcacctgggcgcc
                             ** * *   ****  * *** *                     

F1DT57_E1B19K-01      ---------------cagcggggacagagaatcttgaacta---------
F1DT57_E1B19K-02      agaaggggcaccttccagccgtaccagtgcaactttagccagaccaagct
                                     **** *   *** * * *** * * *         

F1DT57_E1B19K-01      --------------ctggcttctacag-----------ccagcagctccg
F1DT57_E1B19K-02      gctgttggagaacgatgccttctccagggtgaacctgaacggcatctttg
                                     ** ***** ***            * *** **  *

F1DT57_E1B19K-01      ----ggtcttcttcgtctacac-----------------agacaaacatc
F1DT57_E1B19K-02      acatggatgtctcggtgtacaagatcctgagatacgatgagaccaa-gtc
                          **   ***  ** ****                  **** **  **

F1DT57_E1B19K-01      catgtt----------------ggaggaagaaat-----gaggca-----
F1DT57_E1B19K-02      cagggtgcgcgcttgcgagtgcgggggcagacacaccaggatgcagccag
                      ** * *                ** ** *** *      ** ***     

F1DT57_E1B19K-01      -ggccatggacgagaacccgaggagc----------------------gg
F1DT57_E1B19K-02      tggccctggatgtga--ccgaggagctgagaccagaccacctggtgatgg
                       **** **** * **  *********                      **

F1DT57_E1B19K-01      tctggacc--------------ctccgtcggaagaggagttggattga
F1DT57_E1B19K-02      cctgtaccgggaccgagttcagctccagtgg-ggaggacacagattag
                       *** ***              ****   **  *****    ****  

© 1998-2023Legal notice