Dataset for CDS adenoviridae of organism Human adenovirus C serotype 5

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3G8W3H5_E1B19K-      atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
Q6VGV8_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
Q6WQ37_E1B19K-01        atggaggcttgggagtgtttggaagatttttctgctgtgcgtaacttgct
                        **************************************************

A0A3G8W3H5_E1B19K-      ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
Q6VGV8_E1B19K-01        ggaacagagctctaacagtacctcttggttttggaggtttctgtggggct
Q6WQ37_E1B19K-01        ggaacagagctctaacagtacctcttggttctggaggtttctgtggggct
                        ****************************** *******************

A0A3G8W3H5_E1B19K-      cctcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
Q6VGV8_E1B19K-01        catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
Q6WQ37_E1B19K-01        catcccaggcaaagttagtctgcagaattaaggaggattacaagtgggaa
                        * ************************************************

A0A3G8W3H5_E1B19K-      tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
Q6VGV8_E1B19K-01        tttgaagagcttttgaaatcctgtggtgagctgtttgattctttgaatct
Q6WQ37_E1B19K-01        ttcgaagagcttttgaagtcctgtggtgagctgtttgattctttgaatct
                        ** ************** ********************************

A0A3G8W3H5_E1B19K-      gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
Q6VGV8_E1B19K-01        gggtcaccaggcgcttttccaagagaaggtcatcaagactttggattttt
Q6WQ37_E1B19K-01        gggtcaccaggcgcttctccaagagaaggtcatcaagactttggattttt
                        **************** *********************************

A0A3G8W3H5_E1B19K-      ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
Q6VGV8_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
Q6WQ37_E1B19K-01        ccacaccggggcgcgctgcggctgctgttgcttttttgagttttataaag
                        **************************************************

A0A3G8W3H5_E1B19K-      gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
Q6VGV8_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
Q6WQ37_E1B19K-01        gataaatggagcgaagaaacccatctgagcggggggtacctgctggattt
                        **************************************************

A0A3G8W3H5_E1B19K-      tctggccatgcatctgtggagagcggtggtgagacacaagaatcgcctgc
Q6VGV8_E1B19K-01        tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
Q6WQ37_E1B19K-01        tctggccatgcatctgtggagagcggttgtgagacacaagaatcgcctgc
                        *************************** **********************

A0A3G8W3H5_E1B19K-      tactgttgtcttccgtccgcccggcaataataccgacggagg------ag
Q6VGV8_E1B19K-01        tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcag
Q6WQ37_E1B19K-01        tactgttgtcttccgtccgcccggcgataataccgacggaggagcagcag
                        ************************* ****************      **

A0A3G8W3H5_E1B19K-      caacagcaggaggaagccaggcggcggcggcggcaggagcagagcccatg
Q6VGV8_E1B19K-01        cagcagcaggaggaagcca---ggcggcggcggcaggagcagagcccatg
Q6WQ37_E1B19K-01        cagcagcaggaggaagcca---ggcggcggcggcaggagcagagcccatg
                        ** ****************   ****************************

A0A3G8W3H5_E1B19K-      gaacccgagagccggcctggaccctcgggaatga
Q6VGV8_E1B19K-01        gaacccgagagccggcctggaccctcgggaatga
Q6WQ37_E1B19K-01        gaacccgagagccggcctggaccctcgggaatga
                        **********************************

© 1998-2020Legal notice