Dataset for CDS adenoviridae of organism Human adenovirus C serotype 5

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q6VGV8_E1B19K-02        atggagcgaagaaacccatctgagcggggggtacctgctggattttctgg
A0A3G8W3H5_E1B19K-      atgga----------------ggcttgggagtgtttggaagatttttctg
Q6VGV8_E1B19K-01        atgga----------------ggcttgggagtgtttggaagatttttctg
Q6WQ37_E1B19K-01        atgga----------------ggcttgggagtgtttggaagatttttctg
                        *****                *    *** **   **   ******   *

Q6VGV8_E1B19K-02        ccatgcatctgtggagagcggttgtgagacacaagaatcgcctgctactg
A0A3G8W3H5_E1B19K-      ctgtgc------------------------------gtaacttgct----
Q6VGV8_E1B19K-01        ctgtgc------------------------------gtaacttgct----
Q6WQ37_E1B19K-01        ctgtgc------------------------------gtaacttgct----
                        *  ***                               *  * ****    

Q6VGV8_E1B19K-02        ttgtcttccgtccgcccggcgataataccgacggaggagcagcagcagca
A0A3G8W3H5_E1B19K-      --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------

Q6VGV8_E1B19K-02        gcaggaggaagccaggcggcggcggcaggagcagagcccatggaacccga
A0A3G8W3H5_E1B19K-      ---------------------------ggaacagagctc-----------
Q6VGV8_E1B19K-01        ---------------------------ggaacagagctc-----------
Q6WQ37_E1B19K-01        ---------------------------ggaacagagctc-----------
                                                   *** ****** *           

Q6VGV8_E1B19K-02        gagccggcctggaccctcgggaatgaatgttgtacaggtggctgaactgt
A0A3G8W3H5_E1B19K-      -------------------------------------------taacagt
Q6VGV8_E1B19K-01        -------------------------------------------taacagt
Q6WQ37_E1B19K-01        -------------------------------------------taacagt
                                                                    *** **

Q6VGV8_E1B19K-02        atccagaactgagacgcattttgacaattacagaggatgggcaggggcta
A0A3G8W3H5_E1B19K-      acc---------------tcttg---gttttggaggtt------------
Q6VGV8_E1B19K-01        acc---------------tcttg---gttttggaggtt------------
Q6WQ37_E1B19K-01        acc---------------tcttg---gttctggaggtt------------
                        * *               * ***    **   **** *            

Q6VGV8_E1B19K-02        aagggggtaaagagggagcggggggcttgtgaggctacagaggaggctag
A0A3G8W3H5_E1B19K-      -------------------------tctgtggggct--------------
Q6VGV8_E1B19K-01        -------------------------tctgtggggct--------------
Q6WQ37_E1B19K-01        -------------------------tctgtggggct--------------
                                                   **** ****              

Q6VGV8_E1B19K-02        gaatctagcttttagcttaatgaccagacaccgtcctgagtgtattactt
A0A3G8W3H5_E1B19K-      -------------------------------cctcccagg----------
Q6VGV8_E1B19K-01        -------------------------------catcccagg----------
Q6WQ37_E1B19K-01        -------------------------------catcccagg----------
                                                       * ***   *          

Q6VGV8_E1B19K-02        ttcaacagatcaaggataattgcgctaatgagcttgatctgctggcgcag
A0A3G8W3H5_E1B19K-      ----------caaagttagtc------------------------tgcag
Q6VGV8_E1B19K-01        ----------caaagttagtc------------------------tgcag
Q6WQ37_E1B19K-01        ----------caaagttagtc------------------------tgcag
                                  *** * ** *                          ****

Q6VGV8_E1B19K-02        aagtattccatagagcagctgaccacttactggctgcagccaggggatga
A0A3G8W3H5_E1B19K-      aa------------------------------------------------
Q6VGV8_E1B19K-01        aa------------------------------------------------
Q6WQ37_E1B19K-01        aa------------------------------------------------

Q6VGV8_E1B19K-02        ttttgaggaggctattagggtatatgcaaaggtggcacttaggccagatt
A0A3G8W3H5_E1B19K-      --ttaaggag------------------------------------gatt
Q6VGV8_E1B19K-01        --ttaaggag------------------------------------gatt
Q6WQ37_E1B19K-01        --ttaaggag------------------------------------gatt
                          ** *****                                    ****

Q6VGV8_E1B19K-02        gcaagtacaagatcagcaaacttgtaaatatcaggaattgttgctacatt
A0A3G8W3H5_E1B19K-      acaagt--------------------------gggaatt-----------
Q6VGV8_E1B19K-01        acaagt--------------------------gggaatt-----------
Q6WQ37_E1B19K-01        acaagt--------------------------gggaatt-----------
                         *****                           ******           

Q6VGV8_E1B19K-02        tctgggaacggggccgaggtggagatagatacggaggatagggtggcctt
A0A3G8W3H5_E1B19K-      -------------------tgaaga--------------------gcttt
Q6VGV8_E1B19K-01        -------------------tgaaga--------------------gcttt
Q6WQ37_E1B19K-01        -------------------cgaaga--------------------gcttt
                                            * ***                    ** **

Q6VGV8_E1B19K-02        tagatgtagcatgataaatatgtggccgggggtgcttggcatggacgggg
A0A3G8W3H5_E1B19K-      tga------------aatcctgtgg----------------tgagctgtt
Q6VGV8_E1B19K-01        tga------------aatcctgtgg----------------tgagctgtt
Q6WQ37_E1B19K-01        tga------------agtcctgtgg----------------tgagctgtt
                        *              *    *****                **  * *  

Q6VGV8_E1B19K-02        tggttattatgaatgtaaggtttactggccccaattttagcggtacggtt
A0A3G8W3H5_E1B19K-      tgattctt-tgaatct------------------------------gggt
Q6VGV8_E1B19K-01        tgattctt-tgaatct------------------------------gggt
Q6WQ37_E1B19K-01        tgattctt-tgaatct------------------------------gggt
                        ** ** ** ***** *                              ** *

Q6VGV8_E1B19K-02        ttcctggccaataccaaccttatcctacacggtgtaagcttctatgggtt
A0A3G8W3H5_E1B19K-      caccaggc-----------------------------gctttt-------
Q6VGV8_E1B19K-01        caccaggc-----------------------------gctttt-------
Q6WQ37_E1B19K-01        caccaggc-----------------------------gcttct-------
                          ** ***                             **** *       

Q6VGV8_E1B19K-02        taacaatacctgtgtggaagcctggaccgatgtaagggttcggggctgtg
A0A3G8W3H5_E1B19K-      --------------------------------------------------
Q6VGV8_E1B19K-01        --------------------------------------------------
Q6WQ37_E1B19K-01        --------------------------------------------------

Q6VGV8_E1B19K-02        ccttttactgctgctggaagggggtggtgtgtcgccccaaaagcagggct
A0A3G8W3H5_E1B19K-      ------------------------------------ccaagagaaggtca
Q6VGV8_E1B19K-01        ------------------------------------ccaagagaaggtca
Q6WQ37_E1B19K-01        ------------------------------------ccaagagaaggtca
                                                            **** ** *** * 

Q6VGV8_E1B19K-02        tcaattaagaaatgcctctttgaaaggtgtaccttgggtatcctgtctga
A0A3G8W3H5_E1B19K-      tcaa-------------------------gactttggattttt-------
Q6VGV8_E1B19K-01        tcaa-------------------------gactttggattttt-------
Q6WQ37_E1B19K-01        tcaa-------------------------gactttggattttt-------
                        ****                          ** **** * *         

Q6VGV8_E1B19K-02        gggtaactccagggtgcgccacaatgtggcctccgactgtggttgcttca
A0A3G8W3H5_E1B19K-      ---ccacaccggggcgcg------------ctgcggctgctgttgctttt
Q6VGV8_E1B19K-01        ---ccacaccggggcgcg------------ctgcggctgctgttgctttt
Q6WQ37_E1B19K-01        ---ccacaccggggcgcg------------ctgcggctgctgttgctttt
                             ** ** *** ***            ** ** ***  *******  

Q6VGV8_E1B19K-02        tgctagtgaaaagcgtggctgtgattaagcataacatggtatgtggcaac
A0A3G8W3H5_E1B19K-      t--------------tgagttttataaaggataa------atggagcga-
Q6VGV8_E1B19K-01        t--------------tgagttttataaaggataa------atggagcga-
Q6WQ37_E1B19K-01        t--------------tgagttttataaaggataa------atggagcga-
                        *              **  * * ** *** ****      ***  ** * 

Q6VGV8_E1B19K-02        tgcgaggacagggcctctcagatgctgacctgctcggacggcaactgtca
A0A3G8W3H5_E1B19K-      -------------------agaaacccatctgagcgggggg-------ta
Q6VGV8_E1B19K-01        -------------------agaaacccatctgagcgggggg-------ta
Q6WQ37_E1B19K-01        -------------------agaaacccatctgagcgggggg-------ta
                                           ***  *  * ***  ***  **        *

Q6VGV8_E1B19K-02        cctgctgaagaccattcacgtagccagccactctcgcaaggcctggccag
A0A3G8W3H5_E1B19K-      cctgctgga----------------------ttt-------tctggcca-
Q6VGV8_E1B19K-01        cctgctgga----------------------ttt-------tctggcca-
Q6WQ37_E1B19K-01        cctgctgga----------------------ttt-------tctggcca-
                        ******* *                      * *        ******* 

Q6VGV8_E1B19K-02        tgtttgagcataacatactgacccgctgttccttgcatttgggtaacagg
A0A3G8W3H5_E1B19K-      ---------------------------------tgcatctgt------gg
Q6VGV8_E1B19K-01        ---------------------------------tgcatctgt------gg
Q6WQ37_E1B19K-01        ---------------------------------tgcatctgt------gg
                                                         ***** **       **

Q6VGV8_E1B19K-02        aggggggtgttcctaccttaccaatgcaatttgagtcacactaagatatt
A0A3G8W3H5_E1B19K-      agagcggt---------------------ggtgagacac---aaga-atc
Q6VGV8_E1B19K-01        agagcggt---------------------tgtgagacac---aaga-atc
Q6WQ37_E1B19K-01        agagcggt---------------------tgtgagacac---aaga-atc
                        ** * ***                       **** ***   **** ** 

Q6VGV8_E1B19K-02        gcttgagcccgagagcatgtccaaggtgaacctgaacggggtgtttgaca
A0A3G8W3H5_E1B19K-      gcctg---------------ctactgt--------------tgtcttccg
Q6VGV8_E1B19K-01        gcctg---------------ctactgt--------------tgtcttccg
Q6WQ37_E1B19K-01        gcctg---------------ctactgt--------------tgtcttccg
                        ** **               * *  **              *** *  * 

Q6VGV8_E1B19K-02        tgaccatgaagatctggaaggtgctgaggtacgatgag-acccgcaccag
A0A3G8W3H5_E1B19K-      tccgcccggcaat------aataccgacggagg------agcaacagcag
Q6VGV8_E1B19K-01        tccgcccggcgat------aataccgacggaggagcagcagcagcagcag
Q6WQ37_E1B19K-01        tccgcccggcgat------aataccgacggaggagcagcagcagcagcag
                        *   *  *   **        * * ** * * *      * *  ** ***

Q6VGV8_E1B19K-02        gtgcagaccctgcgagtgtggcggtaaacatattaggaaccagcctgtga
A0A3G8W3H5_E1B19K-      gaggaagccaggcggcggcggcggc-------------------------
Q6VGV8_E1B19K-01        gaggaagcca---ggcggcggcggc-------------------------
Q6WQ37_E1B19K-01        gaggaagcca---ggcggcggcggc-------------------------
                        * * *  **    *   * *****                          

Q6VGV8_E1B19K-02        tgctggatgtgaccgaggagctgaggcccgatcacttg-gtgctggcctg
A0A3G8W3H5_E1B19K-      ---------------aggagcagagcccatggaacccgagagccggcctg
Q6VGV8_E1B19K-01        ---------------aggagcagagcccatggaacccgagagccggcctg
Q6WQ37_E1B19K-01        ---------------aggagcagagcccatggaacccgagagccggcctg
                                       ****** *** **     **  * * ** ******

Q6VGV8_E1B19K-02        cacccgcgctgagtttggctctagcgatgaagatacagattga
A0A3G8W3H5_E1B19K-      gaccctcg----------------------------ggaatga
Q6VGV8_E1B19K-01        gaccctcg----------------------------ggaatga
Q6WQ37_E1B19K-01        gaccctcg----------------------------ggaatga
                         **** **                             ** ***

© 1998-2022Legal notice