Dataset for CDS adenoviridae of organism Human adenovirus C serotype 2

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A4P2SGW2_E1B19K-      atggagcgaagaaacccatctgagcggggggtacctgctggattttctgg
A0A1U9ALK7_E1B19K-      atgga----------------ggcttgggagtgtttggaagatttttctg
A0A6M5E4Y6_E1B19K-      atgga----------------ggcttgggagtgtttggaagatttttctg
P03247_E1B19K-01        atgga----------------ggcttgggagtgtttggaagatttttctg
A0A4P2SGW2_E1B19K-      atgga----------------ggcttgggagtgtttggaagatttttctg
                        *****                *    *** **   **   ******   *

A0A4P2SGW2_E1B19K-      ccatgcatctgtggagagcggtggtgagacacaagaatcgcctgctactg
A0A1U9ALK7_E1B19K-      ctgtgc------------------------------gtaacttgct----
A0A6M5E4Y6_E1B19K-      ctgtgc------------------------------gtaacttgct----
P03247_E1B19K-01        ctgtgc------------------------------gtaacttgct----
A0A4P2SGW2_E1B19K-      ctgtgc------------------------------gtaacttgct----
                        *  ***                               *  * ****    

A0A4P2SGW2_E1B19K-      ttgtcttccgtccgcccggcaataataccgacggaggagcagcagcagca
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------

A0A4P2SGW2_E1B19K-      gcagcagcagcaggaggaagccaggcggcggcggcggcaggagcagagcc
A0A1U9ALK7_E1B19K-      ---------------------------------------ggaacagagct
A0A6M5E4Y6_E1B19K-      ---------------------------------------ggaacagagct
P03247_E1B19K-01        ---------------------------------------ggaacagagct
A0A4P2SGW2_E1B19K-      ---------------------------------------ggaacagagct
                                                               *** ****** 

A0A4P2SGW2_E1B19K-      catggaacccgagagccggcctggaccctcgggaatgaatgttgtacagg
A0A1U9ALK7_E1B19K-      c-------------------------------------------------
A0A6M5E4Y6_E1B19K-      c-------------------------------------------------
P03247_E1B19K-01        c-------------------------------------------------
A0A4P2SGW2_E1B19K-      c-------------------------------------------------

A0A4P2SGW2_E1B19K-      tggctgaactgtatccagaactgagacgcattttgacaattacagaggat
A0A1U9ALK7_E1B19K-      -----taacagtacc---------------tcttg---gttttggaggtt
A0A6M5E4Y6_E1B19K-      -----taacagtacc---------------tcttg---gttttggaggtt
P03247_E1B19K-01        -----taacagtacc---------------tcttg---gttttggaggtt
A0A4P2SGW2_E1B19K-      -----taacagtacc---------------tcttg---gttttggaggtt
                              *** *** *               * ***    **   **** *

A0A4P2SGW2_E1B19K-      gggcaggggctaaagggggtaaagagggagcggggggcttgtgaggctac
A0A1U9ALK7_E1B19K-      -------------------------------------tctgtggggct--
A0A6M5E4Y6_E1B19K-      -------------------------------------tctgtggggct--
P03247_E1B19K-01        -------------------------------------tctgtggggct--
A0A4P2SGW2_E1B19K-      -------------------------------------tctgtggggct--
                                                               **** ****  

A0A4P2SGW2_E1B19K-      agaggaggctaggaatctagcttttagcttaatgaccagacaccgtcctg
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------

A0A4P2SGW2_E1B19K-      agtgtattacttttcaacagatcaaggataattgcgctaatgagcttgat
A0A1U9ALK7_E1B19K-      ---------cctcccag---------------------------------
A0A6M5E4Y6_E1B19K-      ---------cctcccag---------------------------------
P03247_E1B19K-01        ---------cctcccag---------------------------------
A0A4P2SGW2_E1B19K-      ---------cctcccag---------------------------------
                                 * *  **                                  

A0A4P2SGW2_E1B19K-      ctgctggcgcaaaagtattccatagagcagctgaccacttactggctgca
A0A1U9ALK7_E1B19K-      --------gcaaagttagtctgcagaa-----------------------
A0A6M5E4Y6_E1B19K-      --------gcaaagttagtctgcagaa-----------------------
P03247_E1B19K-01        --------gcaaagttagtctgcagaa-----------------------
A0A4P2SGW2_E1B19K-      --------gcaaagttagtctgcagaa-----------------------
                                *****  ** **   ***                        

A0A4P2SGW2_E1B19K-      gccaggggatgattttgaggaggctattagggtatatgcaaaggtggcac
A0A1U9ALK7_E1B19K-      --------------ttaaggag----------------------------
A0A6M5E4Y6_E1B19K-      --------------ttaaggag----------------------------
P03247_E1B19K-01        --------------ttaaggag----------------------------
A0A4P2SGW2_E1B19K-      --------------ttaaggag----------------------------
                                      ** *****                            

A0A4P2SGW2_E1B19K-      ttaggccagattgcaagtacaagatcagcaaacttgtaaatatcaggaat
A0A1U9ALK7_E1B19K-      --------gattacaagt--------------------------gggaat
A0A6M5E4Y6_E1B19K-      --------gattacaagt--------------------------gggaat
P03247_E1B19K-01        --------gattacaagt--------------------------gggaat
A0A4P2SGW2_E1B19K-      --------gattacaagt--------------------------gggaat
                                **** *****                           *****

A0A4P2SGW2_E1B19K-      tgttgctacatttctgggaacggggccgaggtggagatagatacggagga
A0A1U9ALK7_E1B19K-      t------------------------------tgaaga-------------
A0A6M5E4Y6_E1B19K-      t------------------------------tgaaga-------------
P03247_E1B19K-01        t------------------------------tgaaga-------------
A0A4P2SGW2_E1B19K-      t------------------------------tgaaga-------------
                        *                              ** ***             

A0A4P2SGW2_E1B19K-      tagggtggcctttagatgtagcatgataaatatgtggccgggggtgcttg
A0A1U9ALK7_E1B19K-      -------gcttttga------------aatcctgtgg-------------
A0A6M5E4Y6_E1B19K-      -------gcttttga------------aatcctgtgg-------------
P03247_E1B19K-01        -------gcttttga------------aatcctgtgg-------------
A0A4P2SGW2_E1B19K-      -------gcttttga------------aatcctgtgg-------------
                               ** ***              **   *****             

A0A4P2SGW2_E1B19K-      gcatggacggggtggttattatgaatgtaaggtttactggccccaatttt
A0A1U9ALK7_E1B19K-      ---tgagctgtttgattctt-tgaatct--gggtcaccag----------
A0A6M5E4Y6_E1B19K-      ---tgagctgtttgattctt-tgaatct--gggtcaccag----------
P03247_E1B19K-01        ---tgagctgtttgattctt-tgaatct--gggtcaccag----------
A0A4P2SGW2_E1B19K-      ---tgagctgtttgattctt-tgaatct--gggtcaccag----------
                           **  * *  ** ** ** ***** *  ** * **  *          

A0A4P2SGW2_E1B19K-      agcggtacggttttcctggccaataccaaccttatcctacacggtgtaag
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------

A0A4P2SGW2_E1B19K-      cttctatgggtttaacaatacctgtgtggaagcctggaccgatgtaaggg
A0A1U9ALK7_E1B19K-      --------------------------------------------------
A0A6M5E4Y6_E1B19K-      --------------------------------------------------
P03247_E1B19K-01        --------------------------------------------------
A0A4P2SGW2_E1B19K-      --------------------------------------------------

A0A4P2SGW2_E1B19K-      ttcggggctgtgccttttactgctgctggaagggggtggtgtgtcgcccc
A0A1U9ALK7_E1B19K-      ---------gcgctttt-------------------------------cc
A0A6M5E4Y6_E1B19K-      ---------gcgctttt-------------------------------cc
P03247_E1B19K-01        ---------gcgctttt-------------------------------cc
A0A4P2SGW2_E1B19K-      ---------gcgctttt-------------------------------cc
                                 * ** ***                               **

A0A4P2SGW2_E1B19K-      aaaagcagggcttcaattaagaaatgcctctttgaaaggtgtaccttggg
A0A1U9ALK7_E1B19K-      aagagaaggtcatcaa-------------------------gactttgga
A0A6M5E4Y6_E1B19K-      aagagaaggtcatcaa-------------------------gactttgga
P03247_E1B19K-01        aagagaaggtcatcaa-------------------------gactttgga
A0A4P2SGW2_E1B19K-      aagagaaggtcatcaa-------------------------gactttgga
                        ** ** *** * ****                          ** **** 

A0A4P2SGW2_E1B19K-      tatcctgtctgagggtaactccagggtgcgccacaatgtggcctccgact
A0A1U9ALK7_E1B19K-      ttttt----------ccacaccggggcgcg------------ctgcggct
A0A6M5E4Y6_E1B19K-      ttttt----------ccacaccggggcgcg------------ctgcggct
P03247_E1B19K-01        ttttt----------ccacaccggggcgcg------------ctgcggct
A0A4P2SGW2_E1B19K-      ttttt----------ccacaccggggcgcg------------ctgcggct
                        * *              ** ** *** ***            ** ** **

A0A4P2SGW2_E1B19K-      gtggttgcttcatgctagtgaaaagcgtggctgtgattaagcataacatg
A0A1U9ALK7_E1B19K-      gctgttgcttttt--------------tgagttttataaaggataa----
A0A6M5E4Y6_E1B19K-      gctgttgcttttt--------------tgagttttataaaggataa----
P03247_E1B19K-01        gctgttgcttttt--------------tgagttttataaaggataa----
A0A4P2SGW2_E1B19K-      gctgttgcttttt--------------tgagttttataaaggataa----
                        *  *******  *              **  * * ** *** ****    

A0A4P2SGW2_E1B19K-      gtatgtggcaactgcgaggacagggcctctcagatgctgacctgctcgga
A0A1U9ALK7_E1B19K-      --atggagcga--------------------agaaacccatctgagcggg
A0A6M5E4Y6_E1B19K-      --atggagcga--------------------agaaacccatctgagcggg
P03247_E1B19K-01        --atggagcga--------------------agaaacccatctgagcggg
A0A4P2SGW2_E1B19K-      --atggagcga--------------------agaaacccatctgagcggg
                          ***  ** *                    ***  *  * ***  *** 

A0A4P2SGW2_E1B19K-      cggcaactgtcacctgctgaagaccattcacgtagccagccactctcgca
A0A1U9ALK7_E1B19K-      ggg-------tacctgctgga----------------------ttt----
A0A6M5E4Y6_E1B19K-      ggg-------tacctgctgga----------------------ttt----
P03247_E1B19K-01        ggg-------tacctgctgga----------------------ttt----
A0A4P2SGW2_E1B19K-      ggg-------tacctgctgga----------------------ttt----
                         **        ******** *                      * *    

A0A4P2SGW2_E1B19K-      aggcctggccagtgtttgagcataacatactgacccgctgttccttgcat
A0A1U9ALK7_E1B19K-      ---tctggcca----------------------------------tgcat
A0A6M5E4Y6_E1B19K-      ---tctggcca----------------------------------tgcat
P03247_E1B19K-01        ---tctggcca----------------------------------tgcat
A0A4P2SGW2_E1B19K-      ---tctggcca----------------------------------tgcat
                            *******                                  *****

A0A4P2SGW2_E1B19K-      ttgggtaacaggaggggggtgttcctaccttaccaatgcaatttgagtca
A0A1U9ALK7_E1B19K-      ctgt------ggagagcggtggtgagac-------acaagaatcgcctgc
A0A6M5E4Y6_E1B19K-      ctgt------ggagagcggtggtgagac-------acaagaatcgcctgc
P03247_E1B19K-01        ctgt------ggagagcggtggtgagac-------acaagaatcgcctgc
A0A4P2SGW2_E1B19K-      ctgt------ggagagcggtggtgagac-------acaagaatcgcctgc
                         **       **** * **** *   **       *    * * *  *  

A0A4P2SGW2_E1B19K-      cactaagatattgcttgagcccgagagcatgtccaaggtgaacctgaacg
A0A1U9ALK7_E1B19K-      tactgttgtcttccgtccgcccggcaata---------------------
A0A6M5E4Y6_E1B19K-      tactgttgtcttccgtccgcccggcaata---------------------
P03247_E1B19K-01        tactgttgtcttccgtccgcccggcaata---------------------
A0A4P2SGW2_E1B19K-      tactgttgtcttccgtccgcccggcaata---------------------
                         ***    * ** * *  *****  *  *                     

A0A4P2SGW2_E1B19K-      gggtgtttgacatgaccatgaagatctggaaggtgctgaggtacgatgag
A0A1U9ALK7_E1B19K-      -----------ataccgacggagg---------------agca-------
A0A6M5E4Y6_E1B19K-      -----------ataccgacggagg---------------agca-------
P03247_E1B19K-01        -----------ataccgacggagg---------------agca-------
A0A4P2SGW2_E1B19K-      -----------ataccgacggaggagcagcagcagcagcagca-------
                                   **  * * * **                 * *       

A0A4P2SGW2_E1B19K-      acccgcaccaggtgcagaccctgcgagtgtggcggtaaacatattaggaa
A0A1U9ALK7_E1B19K-      ----acagcaggaggaagccaggcggcggcggcggc--------------
A0A6M5E4Y6_E1B19K-      ----acagcaggaggaagccaggcggcggcggcggc--------------
P03247_E1B19K-01        ----acagcaggaggaagccaggcggcggcggcggc--------------
A0A4P2SGW2_E1B19K-      ----gcagcaggaggaagccaggcggcggcggcggc--------------
                             ** **** * *  **  ***   * *****               

A0A4P2SGW2_E1B19K-      ccagcctgtgatgctggatgtgaccgaggagctgaggcccgatcacttg-
A0A1U9ALK7_E1B19K-      --------------------------aggagcagagcccatggaacccga
A0A6M5E4Y6_E1B19K-      --------------------------aggagcagagcccatggaacccga
P03247_E1B19K-01        --------------------------aggagcagagcccatggaacccga
A0A4P2SGW2_E1B19K-      --------------------------aggagcagagcccatggaacccga
                                                  ****** *** **     **  * 

A0A4P2SGW2_E1B19K-      gtgctggcgtgcacccgcgctgagtttggctctagcgatgaagatacaga
A0A1U9ALK7_E1B19K-      gagccggcctggaccctcg----------------------------gga
A0A6M5E4Y6_E1B19K-      gagccggcctggaccctcg----------------------------gga
P03247_E1B19K-01        gagccggcctggaccctcg----------------------------gga
A0A4P2SGW2_E1B19K-      gagccggcctggaccctcg----------------------------gga
                        * ** *** ** **** **                             **

A0A4P2SGW2_E1B19K-      ttga
A0A1U9ALK7_E1B19K-      atga
A0A6M5E4Y6_E1B19K-      atga
P03247_E1B19K-01        atga
A0A4P2SGW2_E1B19K-      atga

© 1998-2022Legal notice